ID: 1186900148

View in Genome Browser
Species Human (GRCh38)
Location X:14045788-14045810
Sequence TTTCTGTTCTGGGGCATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186900144_1186900148 -9 Left 1186900144 X:14045774-14045796 CCACAATATGTGTCTTTCTGTTC No data
Right 1186900148 X:14045788-14045810 TTTCTGTTCTGGGGCATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186900148 Original CRISPR TTTCTGTTCTGGGGCATTTA TGG Intergenic
No off target data available for this crispr