ID: 1186902467

View in Genome Browser
Species Human (GRCh38)
Location X:14071880-14071902
Sequence TACCCAAGAGAACTGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186902467_1186902472 28 Left 1186902467 X:14071880-14071902 CCTTTTTTCAGTTCTCTTGGGTA No data
Right 1186902472 X:14071931-14071953 TAACTCTGTTTAACTTTTTGAGG No data
1186902467_1186902470 -3 Left 1186902467 X:14071880-14071902 CCTTTTTTCAGTTCTCTTGGGTA No data
Right 1186902470 X:14071900-14071922 GTATATGCCTAGGAATTGCTGGG No data
1186902467_1186902469 -4 Left 1186902467 X:14071880-14071902 CCTTTTTTCAGTTCTCTTGGGTA No data
Right 1186902469 X:14071899-14071921 GGTATATGCCTAGGAATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186902467 Original CRISPR TACCCAAGAGAACTGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr