ID: 1186907029

View in Genome Browser
Species Human (GRCh38)
Location X:14121907-14121929
Sequence TGCAAGTATACCCATGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186907026_1186907029 30 Left 1186907026 X:14121854-14121876 CCATGACAAAGTGAGCAGTTTCT No data
Right 1186907029 X:14121907-14121929 TGCAAGTATACCCATGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186907029 Original CRISPR TGCAAGTATACCCATGGAGG AGG Intergenic
No off target data available for this crispr