ID: 1186907345

View in Genome Browser
Species Human (GRCh38)
Location X:14125909-14125931
Sequence TTCCTGATGATCCAAGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186907345_1186907348 27 Left 1186907345 X:14125909-14125931 CCTGGCACTTGGATCATCAGGAA No data
Right 1186907348 X:14125959-14125981 ACTTTGTCACCACATGAAGAGGG No data
1186907345_1186907347 26 Left 1186907345 X:14125909-14125931 CCTGGCACTTGGATCATCAGGAA No data
Right 1186907347 X:14125958-14125980 GACTTTGTCACCACATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186907345 Original CRISPR TTCCTGATGATCCAAGTGCC AGG (reversed) Intergenic
No off target data available for this crispr