ID: 1186917962

View in Genome Browser
Species Human (GRCh38)
Location X:14244142-14244164
Sequence AAGGAAATGGACGCAGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186917962_1186917968 22 Left 1186917962 X:14244142-14244164 CCAACAGCTGCGTCCATTTCCTT No data
Right 1186917968 X:14244187-14244209 CTCCCTCCCTCACACCGTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186917962 Original CRISPR AAGGAAATGGACGCAGCTGT TGG (reversed) Intergenic
No off target data available for this crispr