ID: 1186917991

View in Genome Browser
Species Human (GRCh38)
Location X:14244298-14244320
Sequence GAGAGCCCCAGCACCAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186917985_1186917991 28 Left 1186917985 X:14244247-14244269 CCAAGAGTTAGCTTCACCAAGAT No data
Right 1186917991 X:14244298-14244320 GAGAGCCCCAGCACCAGCAGTGG No data
1186917989_1186917991 3 Left 1186917989 X:14244272-14244294 CCAGTGATAGGCAAAGGTCCGAT No data
Right 1186917991 X:14244298-14244320 GAGAGCCCCAGCACCAGCAGTGG No data
1186917987_1186917991 12 Left 1186917987 X:14244263-14244285 CCAAGATGTCCAGTGATAGGCAA No data
Right 1186917991 X:14244298-14244320 GAGAGCCCCAGCACCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186917991 Original CRISPR GAGAGCCCCAGCACCAGCAG TGG Intergenic
No off target data available for this crispr