ID: 1186925384

View in Genome Browser
Species Human (GRCh38)
Location X:14328249-14328271
Sequence CCTTATAAGCACATGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186925384_1186925388 12 Left 1186925384 X:14328249-14328271 CCAGCTTCCATGTGCTTATAAGG No data
Right 1186925388 X:14328284-14328306 CTTGCACATTTCCCCTCTCCAGG No data
1186925384_1186925389 20 Left 1186925384 X:14328249-14328271 CCAGCTTCCATGTGCTTATAAGG No data
Right 1186925389 X:14328292-14328314 TTTCCCCTCTCCAGGCACTTTGG No data
1186925384_1186925390 21 Left 1186925384 X:14328249-14328271 CCAGCTTCCATGTGCTTATAAGG No data
Right 1186925390 X:14328293-14328315 TTCCCCTCTCCAGGCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186925384 Original CRISPR CCTTATAAGCACATGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr