ID: 1186925384 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:14328249-14328271 |
| Sequence | CCTTATAAGCACATGGAAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1186925384_1186925388 | 12 | Left | 1186925384 | X:14328249-14328271 | CCAGCTTCCATGTGCTTATAAGG | No data | ||
| Right | 1186925388 | X:14328284-14328306 | CTTGCACATTTCCCCTCTCCAGG | No data | ||||
| 1186925384_1186925389 | 20 | Left | 1186925384 | X:14328249-14328271 | CCAGCTTCCATGTGCTTATAAGG | No data | ||
| Right | 1186925389 | X:14328292-14328314 | TTTCCCCTCTCCAGGCACTTTGG | No data | ||||
| 1186925384_1186925390 | 21 | Left | 1186925384 | X:14328249-14328271 | CCAGCTTCCATGTGCTTATAAGG | No data | ||
| Right | 1186925390 | X:14328293-14328315 | TTCCCCTCTCCAGGCACTTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1186925384 | Original CRISPR | CCTTATAAGCACATGGAAGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||