ID: 1186931941

View in Genome Browser
Species Human (GRCh38)
Location X:14403057-14403079
Sequence CTATGTTTACCTATGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186931935_1186931941 -8 Left 1186931935 X:14403042-14403064 CCATCAAATCCTAGGCTATGTTT No data
Right 1186931941 X:14403057-14403079 CTATGTTTACCTATGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186931941 Original CRISPR CTATGTTTACCTATGGAAGG GGG Intergenic
No off target data available for this crispr