ID: 1186937117

View in Genome Browser
Species Human (GRCh38)
Location X:14462969-14462991
Sequence GGTAGATAAAACCACAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8513
Summary {0: 2345, 1: 4257, 2: 1105, 3: 370, 4: 436}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186937117_1186937126 22 Left 1186937117 X:14462969-14462991 CCATCTTTGTGGTTTTATCTACC 0: 2345
1: 4257
2: 1105
3: 370
4: 436
Right 1186937126 X:14463014-14463036 CTACAATTGGGGTTTTGGTGTGG No data
1186937117_1186937121 9 Left 1186937117 X:14462969-14462991 CCATCTTTGTGGTTTTATCTACC 0: 2345
1: 4257
2: 1105
3: 370
4: 436
Right 1186937121 X:14463001-14463023 TGATGTTGGTGACCTACAATTGG No data
1186937117_1186937119 -5 Left 1186937117 X:14462969-14462991 CCATCTTTGTGGTTTTATCTACC 0: 2345
1: 4257
2: 1105
3: 370
4: 436
Right 1186937119 X:14462987-14463009 CTACCTTTGGTCTTTGATGTTGG 0: 1033
1: 2884
2: 4292
3: 1017
4: 384
1186937117_1186937122 10 Left 1186937117 X:14462969-14462991 CCATCTTTGTGGTTTTATCTACC 0: 2345
1: 4257
2: 1105
3: 370
4: 436
Right 1186937122 X:14463002-14463024 GATGTTGGTGACCTACAATTGGG No data
1186937117_1186937123 11 Left 1186937117 X:14462969-14462991 CCATCTTTGTGGTTTTATCTACC 0: 2345
1: 4257
2: 1105
3: 370
4: 436
Right 1186937123 X:14463003-14463025 ATGTTGGTGACCTACAATTGGGG No data
1186937117_1186937124 17 Left 1186937117 X:14462969-14462991 CCATCTTTGTGGTTTTATCTACC 0: 2345
1: 4257
2: 1105
3: 370
4: 436
Right 1186937124 X:14463009-14463031 GTGACCTACAATTGGGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186937117 Original CRISPR GGTAGATAAAACCACAAAGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr