ID: 1186937122

View in Genome Browser
Species Human (GRCh38)
Location X:14463002-14463024
Sequence GATGTTGGTGACCTACAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186937117_1186937122 10 Left 1186937117 X:14462969-14462991 CCATCTTTGTGGTTTTATCTACC 0: 2345
1: 4257
2: 1105
3: 370
4: 436
Right 1186937122 X:14463002-14463024 GATGTTGGTGACCTACAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186937122 Original CRISPR GATGTTGGTGACCTACAATT GGG Intergenic
No off target data available for this crispr