ID: 1186937872

View in Genome Browser
Species Human (GRCh38)
Location X:14471056-14471078
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186937872_1186937881 0 Left 1186937872 X:14471056-14471078 CCATCAGCTGAGACCCCCCCAAA No data
Right 1186937881 X:14471079-14471101 TGGCTTAAGGACAAATGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186937872 Original CRISPR TTTGGGGGGGTCTCAGCTGA TGG (reversed) Intergenic
No off target data available for this crispr