ID: 1186942170

View in Genome Browser
Species Human (GRCh38)
Location X:14521558-14521580
Sequence CAAGCTGGACACCCTGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186942170_1186942174 7 Left 1186942170 X:14521558-14521580 CCAGCATCAGGGTGTCCAGCTTG No data
Right 1186942174 X:14521588-14521610 TCCAGCTTGCAGATGGTCACAGG No data
1186942170_1186942173 0 Left 1186942170 X:14521558-14521580 CCAGCATCAGGGTGTCCAGCTTG No data
Right 1186942173 X:14521581-14521603 CAGATGGTCCAGCTTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186942170 Original CRISPR CAAGCTGGACACCCTGATGC TGG (reversed) Intergenic
No off target data available for this crispr