ID: 1186944759

View in Genome Browser
Species Human (GRCh38)
Location X:14553496-14553518
Sequence CTTTCTGCCTTGATAGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186944757_1186944759 30 Left 1186944757 X:14553443-14553465 CCTTAAACACTATTGTTATTATC 0: 1
1: 0
2: 1
3: 34
4: 331
Right 1186944759 X:14553496-14553518 CTTTCTGCCTTGATAGATGATGG 0: 1
1: 0
2: 0
3: 16
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186944759 Original CRISPR CTTTCTGCCTTGATAGATGA TGG Intronic
900429340 1:2594502-2594524 CTCTCTGCCTTGATGGACCAGGG + Intronic
905238750 1:36568359-36568381 CTATCTGCCTTGAGGGAGGAGGG - Intergenic
906213256 1:44024080-44024102 CTCTCTGACCTGCTAGATGAGGG + Intronic
908563353 1:65329293-65329315 CTTACTGACTTTATAAATGAAGG - Intronic
910196440 1:84645137-84645159 CATTTAGCCATGATAGATGATGG - Exonic
910439482 1:87238183-87238205 ATTTCTGCCTGGAGAGATCATGG + Intergenic
910783749 1:90971092-90971114 TTTTCTACCTGGATAAATGAAGG - Intronic
910889696 1:92005251-92005273 CTTTCTGCCTTGCTAAATCACGG - Exonic
912847577 1:113089583-113089605 CTGTCTGCCTTTATAAATGCTGG + Intronic
912979685 1:114360017-114360039 CTTTCTGTGTTGATAGTTGTGGG + Intergenic
914821140 1:151104347-151104369 CATTCTGCTTTCATATATGATGG - Intronic
915444906 1:155969066-155969088 TTTTCTGCCTGGATCCATGAGGG - Intronic
917028743 1:170667345-170667367 CTTGCTTCCTAGAGAGATGAGGG + Intronic
917793715 1:178516599-178516621 CTTTCTTCCTTGTTAGATAAAGG + Exonic
918258532 1:182772574-182772596 TTTTTTGTCTTGTTAGATGAAGG - Intergenic
918413342 1:184283279-184283301 CTATCTGGCTTAATAGATGGAGG + Intergenic
920365240 1:205444826-205444848 CTCTCTGCCTTGGGAGATGAAGG - Intronic
920541509 1:206782267-206782289 CTCTCTGGCTTGATAGAAGCAGG + Intergenic
921036980 1:211389421-211389443 GTTTCTGCTGTGATAGATGAGGG + Intergenic
921252793 1:213313237-213313259 CTATCTGCCTTGAAGGCTGAAGG - Intergenic
921634070 1:217471635-217471657 CTTTCTAACTTGATGGAAGAGGG + Intronic
923397428 1:233581027-233581049 CTTTCTGCCTTTACAGAATAAGG - Intergenic
923421459 1:233820030-233820052 CTTTCAGCCTTAAAAAATGAAGG - Intergenic
924248768 1:242109933-242109955 CTTCCTGTCTTGTTAGATGGAGG - Intronic
1063532369 10:6846772-6846794 CTTTATGCCTTTAAAAATGATGG - Intergenic
1065183188 10:23146982-23147004 CATTCTTCCCTGCTAGATGATGG + Intergenic
1066217257 10:33299859-33299881 CTCGCTGCCTTGATAGAAGCTGG + Intronic
1067902474 10:50256656-50256678 CTTTCAGGCTTAATATATGATGG - Intergenic
1069304780 10:66955806-66955828 ATTTCTGCCTTCACAGATGAGGG + Intronic
1073167289 10:101467267-101467289 CTTTCTGATTTGATTGATGAGGG + Intronic
1073344393 10:102771492-102771514 TTTTCTGTCATTATAGATGAGGG - Intronic
1073495321 10:103885460-103885482 CTTTCTGACTAAATAGTTGAAGG - Intronic
1073574986 10:104615071-104615093 CTTTCTGTCTAGAGAGATGCTGG + Intergenic
1074498408 10:114000309-114000331 CTTCTTGCCTAGATAGAGGAGGG - Intergenic
1075624530 10:123952233-123952255 CTTCCTGCTCTGAAAGATGAGGG + Intergenic
1076234292 10:128851748-128851770 CTTTCTCCCTTCAGAAATGAGGG - Intergenic
1078961172 11:16274050-16274072 CTTTCTGTTTTGAAAGATAAGGG - Intronic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1083553401 11:63607599-63607621 GTTTCGGTCTTGAAAGATGAGGG + Intronic
1084051403 11:66602582-66602604 CATGCAGCCTTGAAAGATGATGG + Intronic
1085311268 11:75518303-75518325 CTTCCTGCCTGGAGAGATGAGGG - Intronic
1085433120 11:76473621-76473643 TTTTCTGTATGGATAGATGATGG + Intronic
1085799962 11:79580266-79580288 TTTTCTGCCTGGATACCTGATGG + Intergenic
1085808238 11:79656633-79656655 ATTTCTCCTTAGATAGATGAAGG - Intergenic
1086432676 11:86750411-86750433 ATTTCTGCCATGATGGATGCAGG - Intergenic
1086487707 11:87326268-87326290 CTTTCTGTCTTGAGAGATTCAGG + Intergenic
1086926139 11:92642608-92642630 CTATCTGCCTTGTTTAATGATGG - Intronic
1086953681 11:92915208-92915230 CTTTCAGGATTGATGGATGATGG - Intergenic
1087520395 11:99226511-99226533 CTTTCTGCCTAGATATGTAAGGG - Intronic
1088081953 11:105928699-105928721 CATTCTGCCTTGAGTGATAAAGG + Intronic
1088125122 11:106415156-106415178 GTTTCTGCAGGGATAGATGAAGG + Intergenic
1099159985 12:79228926-79228948 ATTTCTGCCTTGGGAAATGAGGG - Intronic
1100205684 12:92346795-92346817 CTTTCTCCCCTGATGGATGCTGG + Intergenic
1100691068 12:97038945-97038967 CTTTCAGCCTACAGAGATGAAGG + Intergenic
1100713526 12:97282357-97282379 CATTCTGCCATGTTAGATCATGG + Intergenic
1101508881 12:105375027-105375049 CTTTCTTCCTTGATCTATGCTGG - Intronic
1102417553 12:112777476-112777498 CTTGCTGCCTTGACAGCTAATGG - Intronic
1102503547 12:113369322-113369344 TTTTCTCCCCAGATAGATGAAGG - Intronic
1104027982 12:125042971-125042993 TTTTCTGCATTAATAGAAGATGG - Intergenic
1104210925 12:126687872-126687894 CTTTCTGGCCTGACAGATCAGGG - Intergenic
1114030880 14:18579860-18579882 ATTTCTGCCTTCATTCATGAGGG - Intergenic
1117008286 14:51444628-51444650 CTGTCTGCCTTGAATGGTGATGG + Intergenic
1117098036 14:52316778-52316800 GTTTCTGCCCTGACAGAGGATGG - Intronic
1117476413 14:56099692-56099714 CTTTCTTCCATGATAGATCAAGG - Intergenic
1118827634 14:69398428-69398450 CTTTTTGCCTTTATCGAAGATGG - Exonic
1120708053 14:87765006-87765028 TTGTCTGCCTTGTTAGATTAAGG - Intergenic
1121397470 14:93638950-93638972 CTGTCTGCTTTTATAGATGACGG + Intronic
1121913321 14:97812674-97812696 ATCTCTGCCTTGAAAAATGAAGG - Intergenic
1122162716 14:99797150-99797172 CTTTCTGTCTTTATAGATTCTGG + Intronic
1123031870 14:105455817-105455839 CTGTCTGCCTGGAGAGATGTGGG - Intronic
1123769839 15:23518199-23518221 CTTTCTGCTTTGATGCATGTAGG - Intergenic
1124991117 15:34674720-34674742 CTTTCTGCCTTGAGGGATGTGGG + Intergenic
1126499669 15:49331391-49331413 TATTCTGCCTTGATAATTGAGGG + Intronic
1127078789 15:55354344-55354366 CTTTCTGCTCTGATAGGGGATGG - Intronic
1129367718 15:75066941-75066963 CTTTCTACCTTTCTAGAGGAAGG - Intronic
1130857574 15:87854594-87854616 GTTTTTGCCTAGATAGATGATGG - Intergenic
1130909346 15:88260494-88260516 CTTTCTCCCTTGCTAGGTGGAGG - Intergenic
1131867355 15:96725396-96725418 CTGTCTGCCTTGCTAGCTGCTGG + Intergenic
1134043443 16:11084891-11084913 CTTTCTGCCTTCAGAATTGATGG - Intronic
1135130771 16:19852095-19852117 TTTCCTGCCATGATAGGTGAGGG + Intronic
1135741758 16:24981479-24981501 CTTTCTGTTCTGATAAATGAGGG - Intronic
1145806177 17:27732899-27732921 CTTTCAGTCTGGGTAGATGAAGG - Intergenic
1145833333 17:27935417-27935439 CTTTCTTCTTTGATTAATGAGGG + Intergenic
1146153881 17:30502681-30502703 CTTTCAGTCTGGGTAGATGAAGG - Intronic
1146340417 17:32014408-32014430 CTTTTTGCCTTAATTGTTGAAGG - Intronic
1146690821 17:34874713-34874735 CTTCCTGCCTTGGAAGATCAGGG + Intergenic
1148295488 17:46498585-46498607 CTTTTTGCCTTAATTGTTGAAGG - Intergenic
1149200054 17:54175015-54175037 CTTTCTGCCTTCAGAGATTCAGG + Intergenic
1150407110 17:64911355-64911377 CTTTTTGCCTTAATTGTTGAAGG + Intronic
1151204264 17:72494066-72494088 GATTCTGCCTTGAGAAATGAGGG - Intergenic
1157693425 18:49701759-49701781 CTTTCTGCCTAGACTGAGGAAGG - Intergenic
1157782675 18:50454107-50454129 CTACCTGCCTTGATGAATGAAGG + Intergenic
1158405018 18:57153142-57153164 CTGCCTGCCTTGAGAGATCAAGG - Intergenic
1160934704 19:1588470-1588492 CGTTCTGCCTTTTAAGATGAAGG + Intronic
1165575214 19:36809552-36809574 CTTTTTGCCTTTGTTGATGAAGG + Intergenic
926039872 2:9664421-9664443 TTTTCTGGCTTGGTAGATGGAGG - Intergenic
927000982 2:18793913-18793935 CTTCCTGCAGTGGTAGATGAGGG - Intergenic
928609543 2:32977807-32977829 CTTGCTGCCTTGATGGATCCCGG + Intronic
929123809 2:38504657-38504679 CCATCTGTTTTGATAGATGAAGG + Intergenic
929458621 2:42084880-42084902 TTTCCTCCCTTGTTAGATGAAGG + Intergenic
931242290 2:60463988-60464010 CTTTCTGACTTGCTAAATGGAGG - Intronic
934588152 2:95524304-95524326 CTTTCTGCCTTGTTATAAGGAGG + Intergenic
938497326 2:131805913-131805935 ATTTCTGCCTTCATTCATGAGGG + Intergenic
938942628 2:136182407-136182429 CATTCTGCCTTTAAAGATAATGG + Intergenic
941185561 2:162318178-162318200 CTTTCTGCCTGCAGAGGTGAAGG - Exonic
942747559 2:179252546-179252568 TTTTCTGTTTTGATAGAGGAAGG - Intronic
942796972 2:179832549-179832571 CTTTCTGACTTGGTAGACTAAGG - Intronic
945529888 2:210939384-210939406 CTTTCAGCCTTGAGATAAGATGG + Intergenic
947192569 2:227522977-227522999 TTTTTTTCCTTGATAGATGTTGG + Intronic
948633266 2:239316112-239316134 CTTGCTGATTTGGTAGATGAAGG - Intronic
1168830741 20:844112-844134 CTTCCTGCCTGGATGGGTGAGGG + Intronic
1169332185 20:4724724-4724746 CTTGCGGCCTTGCTTGATGAAGG - Exonic
1169345578 20:4825553-4825575 TATTCTGCCTTGAAGGATGAAGG - Intergenic
1169939452 20:10920733-10920755 CTTTCTGCCTTTCTATATCATGG + Intergenic
1170742690 20:19071997-19072019 CTTTCTTCCTTGCTAGCCGAAGG + Intergenic
1170960533 20:21021612-21021634 ATTTCTGCCAGGATAGTTGAGGG + Intergenic
1173254739 20:41386399-41386421 CTTTCTTCATTGCTAGATCAAGG + Intergenic
1173759261 20:45545546-45545568 CTTTGTGCCCTGATCGCTGAGGG - Intronic
1174944403 20:54969308-54969330 CTCTCTGCATTGTTAAATGATGG - Intergenic
1178086599 21:29118627-29118649 CTTTGTGCCTTCACAGATCAAGG - Intronic
1178725525 21:35048168-35048190 CTTTCTCTCTTGAAAGATGCTGG + Intronic
1184939935 22:47756687-47756709 CTTTCTGCCTTTAGAAATGTGGG - Intergenic
949207563 3:1458472-1458494 CTTTCTGCCTTGATGGCAGTGGG + Intergenic
952652580 3:35744209-35744231 CTTTCTGCTTTAACAGAAGAAGG - Intronic
952744682 3:36765240-36765262 CTTTGTGACTTGATTGATAAAGG - Intergenic
952932882 3:38373835-38373857 TTATCTGCCTTGATTGCTGAAGG - Intronic
953738716 3:45518059-45518081 GTTTCTGACCTGAGAGATGACGG - Exonic
956736586 3:72243302-72243324 CTTTCTGCCTTGACAGACTCAGG - Intergenic
956928526 3:74016070-74016092 CTTTCTGCCTTCATAGAATTCGG + Intergenic
956969965 3:74511410-74511432 CTTTATGCCTTGAAGGATAAAGG - Intronic
957578974 3:82046169-82046191 CATTCTGATTGGATAGATGAGGG - Intergenic
960357280 3:116669197-116669219 CTTTCTCCCTTGAAGGATGAAGG + Intronic
962897913 3:139732527-139732549 CTTTTTCCCATGAAAGATGAAGG + Intergenic
963039518 3:141058496-141058518 CTTACTGGGTTGAGAGATGATGG + Intronic
964226480 3:154408742-154408764 CTATCTGCCTTGGTAGTCGAAGG + Intronic
965927140 3:173995548-173995570 CTTTCTGCCCTGAGTGAAGAGGG + Intronic
966592411 3:181696987-181697009 CAAACTGTCTTGATAGATGAGGG - Intergenic
967087954 3:186110876-186110898 CTATCTCCCTAGCTAGATGAAGG + Intronic
967765154 3:193271215-193271237 CTTCCTGCCTGTGTAGATGAGGG + Intronic
969095822 4:4731969-4731991 CTTTTTGGCTTTATACATGAAGG + Intergenic
969207444 4:5657355-5657377 CTTCCTACCATGACAGATGATGG + Intronic
969461874 4:7333312-7333334 CTTTCTGCCTAGCTGGCTGATGG + Intronic
969514719 4:7640660-7640682 CTTTCTGCCCTGTGAGGTGATGG + Intronic
970554562 4:17218126-17218148 CTTCCTGGCTTTAAAGATGAAGG - Intergenic
972137521 4:35909760-35909782 ATTTCTGCTTTTATAGATGAGGG - Intergenic
972323678 4:37995354-37995376 CTTCCTGCTTTTACAGATGAAGG - Intronic
972877674 4:43384248-43384270 CTCTCTGACCTGATATATGATGG - Intergenic
973133180 4:46673373-46673395 TTTGGTGCCTTGATAGATAACGG - Intergenic
974256572 4:59463650-59463672 CTGTCTGAATTCATAGATGATGG - Intergenic
974595080 4:64003773-64003795 TTTTCTTCCATGATAGATGTCGG - Intergenic
976112669 4:81692767-81692789 TTTTCTGCCTTGTTTGGTGACGG - Intronic
976919363 4:90418960-90418982 CATTCTCTCTTCATAGATGAAGG + Intronic
977430220 4:96922709-96922731 CTATTTGACTTGATAGATGACGG + Intergenic
978004087 4:103595511-103595533 CTTTCCCCTTTGATACATGAAGG - Intronic
978710712 4:111777188-111777210 CGTTCTCCCTTGATTGATGGGGG + Intergenic
978945946 4:114496246-114496268 CATTTTGCCTTCATACATGATGG - Intergenic
979520004 4:121654977-121654999 ATTCCTGCCATGATAGATGGTGG - Intergenic
981308627 4:143272932-143272954 CTTAGTGAGTTGATAGATGAAGG + Intergenic
982755486 4:159213687-159213709 TTATCTTCCTAGATAGATGAGGG + Intronic
984233192 4:177124650-177124672 CTTTCTATTTTGATAGATGCAGG - Intergenic
984899176 4:184569622-184569644 CTTTTTGCCTTCGTTGATGAAGG - Intergenic
985132796 4:186756262-186756284 GTTGCTGTTTTGATAGATGATGG - Intergenic
986506755 5:8459541-8459563 CGCTGTGCCTTGAAAGATGAAGG + Intergenic
990081990 5:51928338-51928360 CTTTATACTTTGATAGGTGAAGG + Intergenic
990742828 5:58929756-58929778 ATATCTGCCTTGAAAGATCAGGG - Intergenic
991254149 5:64596311-64596333 CTGTCTGCCTTGAGAGATCATGG + Intronic
992188694 5:74268740-74268762 TTTTCTCCCCTGATGGATGACGG + Intergenic
994493514 5:100479258-100479280 CTTTCTCCCTTGACAGTAGAGGG + Intergenic
994971908 5:106750024-106750046 CTTTCTGCATTGATTAATCATGG - Intergenic
998630846 5:143896891-143896913 CTTTGTGCCATGATTGTTGAGGG + Intergenic
1001258385 5:170203267-170203289 CTTTGTGACTTGACAGGTGAAGG - Intergenic
1002077710 5:176718825-176718847 CTTTCTTCCTTGACAGAGCAGGG - Intergenic
1003281834 6:4699684-4699706 CTTTCTGCTTTAATGAATGAGGG + Intergenic
1004348567 6:14870739-14870761 CTTTCTTCCTTGATAGTGTAGGG - Intergenic
1006169660 6:32085751-32085773 CATAATGCCTTGGTAGATGATGG + Intronic
1008372212 6:50745592-50745614 CATTTTGCCTTAATAAATGAGGG + Intronic
1008752508 6:54753473-54753495 ATTTCTTCATTTATAGATGAAGG - Intergenic
1009699547 6:67158820-67158842 CTTTCAGCCTTTAAAGATGTAGG + Intergenic
1009832484 6:68956008-68956030 TTTTCTGCTTTGGTAGTTGATGG + Exonic
1010905541 6:81482910-81482932 CTTTCTGAATTCAAAGATGAAGG - Intergenic
1011948240 6:92934180-92934202 ATTTCTGCCTTGTTAGATTTCGG - Intergenic
1012376609 6:98569479-98569501 GTTTAAGCCTTGATAGATAATGG - Intergenic
1014250236 6:119108233-119108255 TTTGATGCCTTGATATATGATGG + Intronic
1015016887 6:128424398-128424420 CTTACTTCCTTGAGAGATGTGGG - Intronic
1020777047 7:12468162-12468184 CTTTCTCACTTGGTATATGATGG - Intergenic
1021439591 7:20662775-20662797 CCTTCTCCTTTGATAGATCAGGG + Intronic
1022330124 7:29370764-29370786 CAGTCTGCCTTGATACATGGTGG + Intronic
1024396763 7:48878281-48878303 CTCTCTACATGGATAGATGATGG + Intergenic
1024565475 7:50676660-50676682 CCTTTAGCCTTGAGAGATGAGGG - Intronic
1024772788 7:52744192-52744214 TTTTCTGACTTGTTTGATGAGGG - Intergenic
1025969894 7:66313073-66313095 TTTTGTGCCTTGATATATGCAGG - Intronic
1027423808 7:78042140-78042162 CTTTCTTCCTTGATTAATAAAGG + Intronic
1027998981 7:85466966-85466988 CTTTCATCCTTGATTGATGGAGG + Intergenic
1028324959 7:89511980-89512002 CTTTGTGCCTTGATCCATTATGG - Intergenic
1028856077 7:95596087-95596109 CTTTCAGCCTTGGTAGAGGGAGG - Intronic
1028974826 7:96901053-96901075 TTTTCTGCTTTGAGAAATGAGGG - Intergenic
1030378481 7:108782413-108782435 TTTTCTGCATTGAGAAATGAAGG + Intergenic
1030547237 7:110911750-110911772 CTTTCTTCCTTGATAAATATGGG - Intronic
1030887884 7:114961226-114961248 CTTTCTCTCTTGATCAATGATGG + Intronic
1031575695 7:123413268-123413290 CTATCTGAATTGTTAGATGAAGG + Intergenic
1032510171 7:132466103-132466125 CTTTCTGCCTAGCTGGCTGATGG - Intronic
1032740645 7:134735031-134735053 CTTCCTGCATTGGTACATGAGGG - Intergenic
1032746777 7:134794037-134794059 CTGTCTGCCATGATACATGCAGG + Intronic
1036818009 8:11916444-11916466 CTCTCCGCCTTGAAATATGAAGG - Intergenic
1037875539 8:22545472-22545494 CTTTGTGACTGCATAGATGAAGG - Intronic
1042286648 8:67120129-67120151 CTTTCTGCATTGAGAGATATTGG + Intronic
1042351756 8:67784076-67784098 CTTCCTGGCTTTATAGATGTGGG - Intergenic
1043557509 8:81449259-81449281 TTTTCTGCCTAAATAAATGAAGG + Intergenic
1048207016 8:132423424-132423446 CTTCCTGCCTTTTCAGATGATGG - Intronic
1048482716 8:134815012-134815034 CTTTTTTCCTTTATAGAAGAGGG - Intergenic
1050019378 9:1267906-1267928 CTGTCTGCCTGGCTATATGAGGG + Intergenic
1050904933 9:10992544-10992566 CTTTCTGCTTTTATAGATACTGG - Intergenic
1054174090 9:61863105-61863127 CTTTAAGCCTTGATAGGAGACGG + Intergenic
1054663447 9:67717676-67717698 CTTTAAGCCTTGATAGGAGACGG - Intergenic
1054811865 9:69441445-69441467 CTTTTTGGCTTCAAAGATGAAGG + Intronic
1055571334 9:77620123-77620145 CTATCTGCCTTGAATGATCAAGG + Intronic
1055602354 9:77932977-77932999 ATTTCTGGCTTGATGGATGGAGG + Intronic
1057787301 9:98096612-98096634 GTTTCTGGCCTGAGAGATGAAGG - Intronic
1058612009 9:106787900-106787922 CTTTCTGCCATGTTCGATGGCGG + Intergenic
1062114068 9:134798148-134798170 GTTTCTCCCTTGGTAGATGAGGG + Intronic
1186944759 X:14553496-14553518 CTTTCTGCCTTGATAGATGATGG + Intronic
1189044311 X:37574167-37574189 CTTTCTGGCTTGAAAGGTGTAGG + Intronic
1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG + Intergenic
1189451602 X:41137637-41137659 CTTTCTGGCTGGATAGAAAAAGG - Intronic
1192004795 X:67198964-67198986 CTCTCTGCCTTGAAAGCTTAGGG - Intergenic
1192682828 X:73269227-73269249 CTTTTTGCTTTCAGAGATGAAGG - Intergenic
1193479614 X:82010975-82010997 CCTGCTGCCTTGATAGATTCTGG + Intergenic
1194069318 X:89300279-89300301 CTATCTGCCTTATTAGATAAAGG - Intergenic
1196645453 X:118112844-118112866 CTTTATTCCTTGAGAGATTAGGG - Intronic
1196739673 X:119013645-119013667 CTTTCTGCCTTAGGGGATGATGG - Intronic
1198401879 X:136276559-136276581 CTTTCTGGTTTAGTAGATGATGG + Intergenic
1198624984 X:138560996-138561018 CCTTCTGCTTTGAAAGATGGTGG - Intergenic
1200755844 Y:6989269-6989291 CAGTCTGGCTTGATGGATGAGGG + Intronic