ID: 1186946781

View in Genome Browser
Species Human (GRCh38)
Location X:14577446-14577468
Sequence CTAATTAAGACTGGTGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186946781_1186946784 -2 Left 1186946781 X:14577446-14577468 CCTGGTACACCAGTCTTAATTAG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1186946784 X:14577467-14577489 AGCTCAGGCTGTGATAACAAAGG 0: 1
1: 0
2: 0
3: 18
4: 229
1186946781_1186946785 7 Left 1186946781 X:14577446-14577468 CCTGGTACACCAGTCTTAATTAG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1186946785 X:14577476-14577498 TGTGATAACAAAGGATTGATTGG 0: 1
1: 0
2: 0
3: 8
4: 148
1186946781_1186946786 11 Left 1186946781 X:14577446-14577468 CCTGGTACACCAGTCTTAATTAG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1186946786 X:14577480-14577502 ATAACAAAGGATTGATTGGTTGG 0: 1
1: 0
2: 0
3: 12
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186946781 Original CRISPR CTAATTAAGACTGGTGTACC AGG (reversed) Intronic
909657011 1:78043820-78043842 CTGCTTAACACTGGTGTTCCTGG - Intronic
911506516 1:98759133-98759155 CTGATTAACACTGGTCCACCTGG - Intronic
911552712 1:99303802-99303824 CAAATTAAAATTGGTGTGCCAGG + Intronic
916534447 1:165690551-165690573 CTCATTAGGACTGGTTCACCTGG + Intronic
917084089 1:171288300-171288322 TTACTTAAGACTGGTCTAGCAGG - Intergenic
919230237 1:194764212-194764234 CTAATTAATCATGGTGTTCCTGG - Intergenic
920994424 1:210975157-210975179 CTAATAAAGACTGGTAAAACTGG - Intronic
923693256 1:236218725-236218747 CTCATTAAGACTGGTTTAGAAGG + Intronic
924414476 1:243844941-243844963 CCACATAACACTGGTGTACCTGG - Intronic
1064311893 10:14219106-14219128 CTAATTGAGCCTTGTGTATCTGG - Intronic
1070471798 10:76787798-76787820 CTACTGTAGACTGTTGTACCAGG + Intergenic
1076106669 10:127828834-127828856 CTAATTAAGAATGGTCAAGCTGG + Intergenic
1082018970 11:47515179-47515201 ATACTTAACACTGGTGTGCCTGG - Intronic
1086863351 11:91950915-91950937 CTAATGAGTAATGGTGTACCTGG - Intergenic
1092754110 12:11747026-11747048 CTCCTTAAGACTGGTGAAGCGGG + Intronic
1093264985 12:16992064-16992086 CTGATTAAGACTGGGGTGGCAGG - Intergenic
1095856634 12:46866926-46866948 CTAATAAAGATTTTTGTACCAGG - Intergenic
1100679215 12:96900659-96900681 CTGATTAAGACTGGAGTGGCAGG + Intergenic
1110728065 13:78849226-78849248 CCAAATAAGACTGGTGTCCAGGG + Intergenic
1116414854 14:44667638-44667660 CTAATTAATCTTGGTGTTCCTGG + Intergenic
1116801355 14:49447259-49447281 CTATTCAAGACTGGTTTACAGGG + Intergenic
1117744653 14:58856425-58856447 CTGAATAAGACTGGTGAACGTGG + Intergenic
1125533267 15:40427884-40427906 CTAATTAAGACTGGACTGCCAGG + Intronic
1126865953 15:52937101-52937123 CTGATTAAGACTGGGGTGGCAGG + Intergenic
1127587597 15:60393615-60393637 CTAATTAAGATTGAGGTTCCTGG - Intronic
1133473813 16:6100731-6100753 TTAATTAAGATTGATGGACCGGG - Intronic
1137520755 16:49193519-49193541 TTAATTAGGACTGGTGGTCCTGG - Intergenic
1140260882 16:73378474-73378496 CTAAGTAACTCTTGTGTACCTGG + Intergenic
1141637280 16:85320970-85320992 CTAAATAAGACTGGAGTGACGGG - Intergenic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1150426393 17:65080618-65080640 TTTATTAAGACTGGTGTTACGGG - Intergenic
1151221346 17:72615366-72615388 ATAAATAAGTCAGGTGTACCAGG + Intergenic
1151435524 17:74093829-74093851 AAAATTAAGAGTGGTGAACCAGG - Intergenic
1154970550 18:21404325-21404347 GTCATTAAGACTGGAGTTCCAGG + Intronic
1162651828 19:12094335-12094357 ATAAATAAGACTGGTGGGCCAGG - Intronic
1164617522 19:29675834-29675856 CTGAGAAAGGCTGGTGTACCTGG - Intergenic
930389282 2:50740194-50740216 CTAATCAAGACTCATGTCCCTGG - Intronic
933599520 2:84315619-84315641 CTCATTAAGACACTTGTACCAGG - Intergenic
940525297 2:154806891-154806913 CTAATATACCCTGGTGTACCTGG - Intronic
940819649 2:158338100-158338122 CTAGTTCAGAGTGGTGTATCCGG + Intronic
941264330 2:163341256-163341278 CTTATGAAGACTGGTCTTCCTGG - Intergenic
1173612561 20:44381013-44381035 TTAATTAAGACTTTTGCACCTGG + Intronic
1175299173 20:57930619-57930641 ATAATTAAGACTGGAGGCCCAGG - Intergenic
954578182 3:51688299-51688321 CTCATTAAGACTGGTGAATTTGG - Intronic
956354274 3:68373744-68373766 CAAATTAAGATTGGCGTATCTGG - Intronic
960448709 3:117779480-117779502 CTATGTCTGACTGGTGTACCTGG + Intergenic
960536944 3:118825242-118825264 CTAAAGAAAACTGGTGTAGCTGG - Intergenic
966061927 3:175768203-175768225 CTAAATAAAACTCGTGTACCAGG + Intronic
977300338 4:95260382-95260404 CTGATTAAGACTGGGGTGGCAGG + Intronic
979577354 4:122309840-122309862 TTAATTAAGGCTGGCGTTCCTGG - Intronic
982116250 4:152100621-152100643 CTAATTAAGATTGGAGGACTGGG + Intergenic
992626683 5:78642379-78642401 CTAGTTAAGAGGGATGTACCTGG - Intronic
993742387 5:91556885-91556907 CTATGTCTGACTGGTGTACCTGG + Intergenic
993753949 5:91703927-91703949 CTAGTTAAGACAGGTTTACAGGG - Intergenic
998205924 5:140156898-140156920 ATAATTTAGACTGGGGGACCAGG + Intergenic
1008447236 6:51606654-51606676 CTAATTAAAACTAGAGTACTTGG - Intergenic
1011719997 6:90145659-90145681 CCAAATATGACTGGTGTGCCAGG + Intronic
1012099192 6:95009075-95009097 CTATTTAAGACAGTTGTATCAGG + Intergenic
1015563104 6:134537634-134537656 GTAATTAAGAGTGGAGTAACAGG + Intergenic
1024307305 7:47939638-47939660 TTAATTAAGACTGGGCTACCTGG - Intronic
1024710582 7:52010737-52010759 CTAACTAAAACTGGTTTTCCTGG + Intergenic
1025759217 7:64374605-64374627 CTAATAAGGACTCTTGTACCTGG + Intergenic
1036293195 8:7513667-7513689 CTAATTACGACTGGAGTCACTGG + Intergenic
1036566059 8:9938944-9938966 CTAATTAAGAAAAGTGGACCGGG - Intergenic
1040375676 8:46822499-46822521 CTAATAACGACTCTTGTACCTGG + Intergenic
1041758501 8:61339088-61339110 CTCATAAAGACTGGTGGGCCAGG + Intronic
1043370051 8:79580659-79580681 CTAACAAAGACTGCAGTACCTGG + Intergenic
1044047236 8:87451107-87451129 CAAAATACGACAGGTGTACCAGG - Intronic
1047223355 8:122936906-122936928 CTAATTCTGACTGCTGTACTTGG + Intronic
1050447273 9:5738812-5738834 CTAATTAATTATGGTGTTCCTGG - Intronic
1052161381 9:25264185-25264207 TTAATTTAGACTGGGGTATCAGG - Intergenic
1053279953 9:36813836-36813858 CTAATTTTGACTGGTGTTTCAGG + Intergenic
1056700504 9:88901946-88901968 TTAATTAAAACTTGTGTGCCAGG - Intergenic
1186946781 X:14577446-14577468 CTAATTAAGACTGGTGTACCAGG - Intronic
1187651091 X:21407374-21407396 GTAGTTAAGACAGATGTACCTGG + Intronic
1191769892 X:64743399-64743421 CTAATACAGACTTTTGTACCAGG - Intergenic
1193904191 X:87223265-87223287 CTAATACAGACTTGGGTACCAGG + Intergenic
1194520892 X:94917750-94917772 CTAATTAATCATGGTGTTCCTGG + Intergenic
1194811358 X:98390942-98390964 CTGATTAAGACTGGGGTGGCAGG - Intergenic
1200423226 Y:2995029-2995051 CTGATTAAAACTGGGGTAGCAGG + Intergenic
1200850392 Y:7877216-7877238 CTAATAATGACTCTTGTACCTGG - Intergenic
1200866226 Y:8046595-8046617 CTAATAATGACTCTTGTACCTGG + Intergenic
1200897505 Y:8391287-8391309 CTAATAATGACTCTTGTACCTGG - Intergenic
1200900918 Y:8431064-8431086 CTAATAATGACTCTTGTACCTGG - Intergenic
1202259644 Y:22957073-22957095 CTAATAATGACTCTTGTACCAGG + Intergenic
1202412630 Y:24590817-24590839 CTAATAATGACTCTTGTACCAGG + Intergenic
1202458150 Y:25079253-25079275 CTAATAATGACTCTTGTACCAGG - Intergenic