ID: 1186948373

View in Genome Browser
Species Human (GRCh38)
Location X:14594849-14594871
Sequence CAGCCACTGGGATTTTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186948367_1186948373 13 Left 1186948367 X:14594813-14594835 CCTTTATAATATTTGGTAAACAT 0: 1
1: 0
2: 2
3: 43
4: 476
Right 1186948373 X:14594849-14594871 CAGCCACTGGGATTTTAGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186948373 Original CRISPR CAGCCACTGGGATTTTAGTC AGG Intronic
900601815 1:3505970-3505992 CACCCACTGGGATGTAGGTCTGG - Intronic
904080601 1:27870108-27870130 GAGACACTGGGATTTTAACCCGG - Intergenic
907774835 1:57503763-57503785 CATCCACTGGGATTTCGCTCAGG + Intronic
908356954 1:63331131-63331153 CAGCTACTGGTATTTCAGGCTGG - Intergenic
909059960 1:70868560-70868582 CAGCCACTAAGATTTTGCTCTGG + Intronic
913415995 1:118608145-118608167 AAGCCACTTGGATTTTATTAAGG + Intergenic
918102934 1:181392141-181392163 AAGACACTGGGATTGTATTCTGG - Intergenic
918544673 1:185669005-185669027 CAGCCACTGGGCATTTTTTCAGG - Intergenic
919910329 1:202107020-202107042 CAGATACTGGGATGTGAGTCTGG + Intergenic
921428293 1:215031260-215031282 TAGCCACTGGGATTTTGGTCAGG + Intronic
922172196 1:223165292-223165314 CTGCCACTGGGAATTTAGGGAGG - Intergenic
922638688 1:227204476-227204498 CAAACTCTGGGATTTTAGTTGGG - Intronic
923399694 1:233604318-233604340 CAGGCACTAGGATTTAAGTCAGG - Intergenic
923410951 1:233708547-233708569 CAGCCACTGTTTTTGTAGTCAGG - Intergenic
923929199 1:238674238-238674260 CAGCCTGTGGCATTTTAGTAGGG + Intergenic
1065357083 10:24852791-24852813 CAGCCAGTGGGCTTATAGCCTGG + Intronic
1067303335 10:45034482-45034504 CAGCCTCTGGGAGTTTAGGATGG + Intergenic
1067489524 10:46685194-46685216 CATCCACTGAGATTATAGTGGGG - Intergenic
1067582040 10:47452198-47452220 CAGCCTCTGGGAATTCAGTTTGG + Intergenic
1067605144 10:47655190-47655212 CATCCACTGAGATTATAGTGGGG + Intergenic
1069530719 10:69217408-69217430 CAGCCTTTGGAATTTTAATCAGG - Intergenic
1069654453 10:70077436-70077458 CAGCTACTGGGATTACAGGCCGG + Intronic
1071159950 10:82734206-82734228 CAGCCACTGGGCTTTTCCTTGGG + Intronic
1071383159 10:85091491-85091513 AAGCCACTGGGATTTTGATAGGG + Intergenic
1075992298 10:126848402-126848424 CTGCCACTGGGATTCGACTCTGG + Intergenic
1080775053 11:35378231-35378253 AAGCCACTGTGATTTGAGCCTGG - Intronic
1081274790 11:41135079-41135101 CATGGACTGTGATTTTAGTCAGG - Intronic
1083606468 11:63981853-63981875 CAGACACCTTGATTTTAGTCTGG + Intronic
1084182609 11:67454346-67454368 CAGCCACTTGGCCTTTAGTTTGG + Intronic
1084716831 11:70879647-70879669 TAGCCACTGGCATTGGAGTCAGG - Intronic
1085051069 11:73380555-73380577 CAGCCACTTGTGTTGTAGTCAGG + Intronic
1086595121 11:88561377-88561399 CCTCCCCTGGGATTCTAGTCAGG - Intronic
1089116640 11:116100552-116100574 TAGCCACTGGTATTTTAGTAAGG - Intergenic
1089216021 11:116835285-116835307 CAGCCACTGGGATTGGGGTTTGG - Intergenic
1089403150 11:118176435-118176457 CAGAGACTGAGATGTTAGTCGGG + Exonic
1090643692 11:128750204-128750226 CAGCCACAGGGAACTTGGTCTGG + Intronic
1091805816 12:3355111-3355133 CAGCCACTGGGAAATGACTCTGG + Intergenic
1091989633 12:4944532-4944554 CAGCCACTGAGAGTTTATTTTGG + Intergenic
1093399988 12:18734015-18734037 ATGCCATTGGGATTTTAGTAGGG + Intronic
1094117813 12:26937030-26937052 CATGCACTGGTATTTTTGTCTGG - Intronic
1095161923 12:38928055-38928077 AAGCAACTGGCATTTTAATCTGG - Intergenic
1095434416 12:42171456-42171478 TAGCCACTGGCATTTCAGACTGG + Intronic
1098990781 12:77063126-77063148 CAGCCACTGTGTTTTCAGGCTGG + Intronic
1099608684 12:84837824-84837846 CAGCAACTGTCATTCTAGTCAGG - Intergenic
1099869263 12:88326041-88326063 CAGCCACTGAGATTTGAGCTAGG + Intergenic
1104436649 12:128762165-128762187 CAGCCACAGTGATTTTAGGTGGG + Intergenic
1106134102 13:26961517-26961539 CAGCCACTGGGGTATTTGCCGGG - Intergenic
1107030086 13:35841937-35841959 CACCCACTGGGATTTCTGTAGGG - Intronic
1109787174 13:67193105-67193127 AAACCAATGTGATTTTAGTCTGG - Intronic
1114408821 14:22481632-22481654 CACCCACAGGAATTTTAGTGTGG - Intergenic
1119660463 14:76447732-76447754 TGGCCACTGGGATGTTAGTTCGG - Intronic
1121004446 14:90479950-90479972 CAAGCACTGGGATTTAAGGCAGG - Intergenic
1121572326 14:94956382-94956404 AAGCCAGTGGGACTTTAGACAGG + Intergenic
1122823920 14:104360475-104360497 CAGCCCCTGGGATCTCAGACTGG + Intergenic
1125278836 15:38023019-38023041 AAGCCACTGGGATTTTTATTGGG - Intergenic
1128221451 15:65971587-65971609 CTGCCACAGGGAGTTCAGTCCGG - Intronic
1128492569 15:68163606-68163628 CAGTCCCCTGGATTTTAGTCTGG - Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1136219909 16:28822514-28822536 GAGCCACTGCGCTTTTAGGCAGG - Intergenic
1143441862 17:6981045-6981067 CATCAACTGGCATTTTAGTGGGG - Intronic
1143875087 17:9985366-9985388 AAGCCAGTGGGATGTCAGTCTGG - Intronic
1145884049 17:28370626-28370648 CAGCTACTGGGCATTTTGTCTGG - Exonic
1146469618 17:33113472-33113494 CAGCCACAGAGATTTGGGTCTGG + Intronic
1148744025 17:49908485-49908507 CAGCTGCTAGGATTTTGGTCAGG - Intergenic
1149771406 17:59324751-59324773 CAGTCACTGGAATTATAGGCAGG - Intergenic
1150009838 17:61493393-61493415 CAACCACTGGCTTTTCAGTCTGG - Intergenic
1151380344 17:73721311-73721333 CAGCCAGTGGGATTGTTTTCTGG + Intergenic
1155199207 18:23503112-23503134 CAGCCTCTGGGAGCTTCGTCAGG - Intergenic
1155965261 18:32029714-32029736 CAACCACTGGGCTTTAAGGCTGG + Intronic
1156188367 18:34689910-34689932 AAGCCACTGGGAGTTCAGACTGG - Intronic
1156797221 18:41061224-41061246 CACCCACTGGGTTCCTAGTCCGG + Intergenic
1164427808 19:28158030-28158052 AAGCCACTGGGCTCTTAGTTTGG - Intergenic
1164813659 19:31177630-31177652 CAAACACTGGGATTTAAGTGAGG - Intergenic
924977100 2:187933-187955 CAGACACAGGTTTTTTAGTCTGG + Intergenic
925808315 2:7674003-7674025 CATCCACTGAGTTTCTAGTCAGG - Intergenic
929088368 2:38190903-38190925 CAGCCTCTGGGGTTTTAATGAGG - Intergenic
931633857 2:64324819-64324841 CAGCCACTGTGCTGTGAGTCAGG + Intergenic
935244502 2:101206410-101206432 AAGCCACTGGGCTTTTAAGCAGG + Intronic
943239843 2:185368463-185368485 CAAGCACTAGGATTTTAGGCAGG - Intergenic
944032148 2:195248064-195248086 ATGCCACTGGGATTTTGGTAGGG - Intergenic
945397371 2:209336556-209336578 AAGCCACTGAGATTTTGGCCAGG + Intergenic
947672272 2:231945607-231945629 AAGCCATTGAGATTTTTGTCTGG - Intergenic
1168771211 20:418008-418030 GAGCCCCTGGGTTTTTAGTCAGG + Intronic
1173184930 20:40833355-40833377 AAGCCATTGGGATTTCAGCCAGG - Intergenic
1175198991 20:57265581-57265603 CAGGCACTGCGATTTCAGCCAGG + Intronic
1175802693 20:61810201-61810223 CTGCCAGTGGGATGTTAGTGTGG - Intronic
1176927930 21:14772665-14772687 AAGCCACTGGGTTTTTTATCAGG - Intergenic
1178300887 21:31451929-31451951 CAGCCACCAGATTTTTAGTCTGG - Intronic
1179052950 21:37904651-37904673 AAGTCACTGGGAATTTAGCCTGG - Intronic
1180232036 21:46432511-46432533 CTGCCACTGGGATTTTCTTAGGG + Intronic
1180653041 22:17394680-17394702 CATCCACTGGGATTTTGATAGGG + Intronic
1183675661 22:39297565-39297587 CTGCCACTGGGAGTTCAGTGGGG + Intergenic
1184044808 22:41966369-41966391 CAGCCACTGGGATTTGGGAATGG + Intergenic
1184915646 22:47567167-47567189 CAGCCATTGGTATTTTAGAAAGG + Intergenic
949643206 3:6063315-6063337 CAGCCAGTGAGCTTTTACTCTGG - Intergenic
950632234 3:14290150-14290172 CAGACACAGGATTTTTAGTCAGG - Intergenic
950802206 3:15562062-15562084 CAGTGACTGGGATGTTAGTTTGG - Intronic
950957322 3:17068160-17068182 CAGCCACTGAGATTGTAGAATGG + Intronic
951333259 3:21390945-21390967 AAGCCACTGGTATTTTATTTTGG - Intergenic
951760222 3:26139344-26139366 AAGCCACTGTGATTTTAATAGGG - Intergenic
954777646 3:53034451-53034473 GAGCAACTGGGATTATAGACAGG - Intronic
956093259 3:65690111-65690133 CAGCCAATGAGATTTAAATCAGG + Intronic
956936949 3:74113379-74113401 CAGCCAGTGGGATTATCTTCTGG - Intergenic
957856276 3:85882460-85882482 AAGCTACTGGGATTTTCCTCGGG + Intronic
969060455 4:4429833-4429855 CAGCCACTGGGAGTTTCTACAGG + Intronic
969178886 4:5422215-5422237 CAGGCAGTGGGAGTTTAGTGGGG + Intronic
971067145 4:23045826-23045848 AAGCCACTGAGATTTTATTAGGG + Intergenic
978106226 4:104904780-104904802 CAGCCACTGGGCTTGGAGCCAGG + Intergenic
979055713 4:115991308-115991330 CAGCCAGTGTTATTTTAGACTGG + Intergenic
985977108 5:3428716-3428738 GGGCCACTGGGATTTTAATAAGG + Intergenic
991267435 5:64738439-64738461 GAGCCATTGGGATTTTGGTAGGG - Intronic
991668367 5:69022590-69022612 CAGGAGCTGGGATTTTACTCTGG + Intergenic
993405032 5:87500417-87500439 CAGACACTAGGATTTTGGTGAGG + Intergenic
1000693167 5:164347479-164347501 CAGCACCTGTGATTTTAGTCAGG - Intergenic
1004646617 6:17568493-17568515 CAGCCACTGCTCTTTTAGTTTGG + Intergenic
1007484580 6:42172095-42172117 CAGCCACTGAGATTTTAGAGTGG + Intronic
1008768814 6:54953315-54953337 CAGCATCTTGGATTTTAATCAGG - Intergenic
1010534729 6:77012440-77012462 CAGCCACAAAGATTTTAGGCTGG + Intergenic
1015789193 6:136949572-136949594 CAGACAATGGAATTTTACTCAGG + Intergenic
1020595432 7:10202453-10202475 CAGACACTGGGATTTACCTCAGG + Intergenic
1023393777 7:39733651-39733673 CAGCCACTGGCCTTGAAGTCCGG - Intergenic
1024897520 7:54277840-54277862 ATGCCACTGTGATTTTAGCCCGG + Intergenic
1026434483 7:70383628-70383650 CAGGCACTGGGATTTTTGGCTGG - Intronic
1031615972 7:123879932-123879954 CAGCAACTGGGATTACAGACTGG - Intergenic
1032301879 7:130695105-130695127 CAGCCACTGGGGGTATAGTAAGG - Intergenic
1035378160 7:158420731-158420753 CAGTCACTGGGATTATCTTCTGG - Intronic
1037095505 8:14981598-14981620 AAGCCACTTGGATTTAAGTTGGG - Intronic
1038768070 8:30448973-30448995 CAGCCCCTGGGATTGAAGTCAGG + Intronic
1041026373 8:53690880-53690902 CAGGCACTGGCATTGGAGTCTGG - Intergenic
1047594576 8:126365526-126365548 CAGACAAGGTGATTTTAGTCGGG + Intergenic
1048335271 8:133497859-133497881 CAGCCACTGTGATGGTAGTGGGG + Intronic
1051664736 9:19457900-19457922 GAGCCTCTGGGATTTTGGTATGG - Intergenic
1052555614 9:30012535-30012557 CAACCAATGGTATTTTAGTTTGG - Intergenic
1054873818 9:70074637-70074659 CAGCCTCTGGGGTTTTCTTCTGG - Intronic
1056241797 9:84655151-84655173 CAGCCTCTGGGACTATAGGCAGG + Intergenic
1060668253 9:125446225-125446247 GAGCCACTGGTATTTTATCCTGG + Intronic
1062150256 9:135014519-135014541 CAGCCCGTGGGATTTCATTCCGG + Intergenic
1062150269 9:135014589-135014611 CAGCCCGTGGGATTTCATTCCGG + Intergenic
1185999040 X:4988294-4988316 CAGCCAATGCAATTTTTGTCTGG - Intergenic
1186881496 X:13871226-13871248 TAGCCACTGGGATTTCTGTGTGG - Intronic
1186948373 X:14594849-14594871 CAGCCACTGGGATTTTAGTCAGG + Intronic
1187677023 X:21726415-21726437 AGGACACTGGGATTTTAGACTGG + Intronic
1192150867 X:68711688-68711710 CAGCCACTAGGATTTCATCCTGG + Intronic
1202360718 Y:24107351-24107373 CATCCACTGAGATTTTTGGCTGG - Intergenic
1202510060 Y:25562767-25562789 CATCCACTGAGATTTTTGGCTGG + Intergenic