ID: 1186956991

View in Genome Browser
Species Human (GRCh38)
Location X:14694351-14694373
Sequence GCACCTACTATGCTTAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186956991 Original CRISPR GCACCTACTATGCTTAAACA TGG Intronic
902140452 1:14349494-14349516 GCACCTACTTTACTGAGACAGGG - Intergenic
903083021 1:20827616-20827638 GCACCTACTATGCAAACAAATGG - Exonic
915610556 1:156988542-156988564 GCACCTTCTAGGCTTTAATATGG - Intronic
918608325 1:186456883-186456905 GCACATACTATGCTTTGAGATGG + Intronic
918901115 1:190419461-190419483 GCACCTAATATACCTAAACTTGG + Intronic
923319122 1:232812493-232812515 GTACCTACTATGAAAAAACATGG - Intergenic
1068572332 10:58643920-58643942 GCACCTACCCTGCTGAAATATGG + Intronic
1069381975 10:67850625-67850647 GCACTTACTATTCTTAAAAATGG - Intergenic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1085830033 11:79889959-79889981 GAGCTTACTATGCTTAAACTTGG - Intergenic
1092915320 12:13184244-13184266 GCACGCACTATGTTTAAGCATGG + Intergenic
1095929446 12:47610914-47610936 ACATCTACTATGCTAAATCATGG + Intergenic
1098898258 12:76086289-76086311 GAACCCACTATACATAAACAAGG + Intergenic
1099819779 12:87695136-87695158 GATCCTACTATGCATAAACATGG - Intergenic
1102560872 12:113761528-113761550 CCTCATACTCTGCTTAAACATGG + Intergenic
1106909107 13:34444217-34444239 CAACCTACTATCCTAAAACAGGG - Intergenic
1108694998 13:52895412-52895434 GTACCTACTATGCATCAGCATGG - Intergenic
1112398891 13:99058671-99058693 GCACCTGGTATGCTCAAATAAGG + Intronic
1122692934 14:103539655-103539677 GCACCTACTATGCTGCTACGAGG - Intergenic
1125263281 15:37851451-37851473 CCACCTTCTATTCTCAAACATGG + Intergenic
1134909828 16:18015218-18015240 GCACCTGCTAAGCTTGAACTTGG + Intergenic
1135350172 16:21722562-21722584 GCACCTACTTTGTTTTAATAAGG - Intronic
1139572611 16:67822632-67822654 TCACCAAATCTGCTTAAACAAGG + Intronic
1155881734 18:31157701-31157723 GCACCTGCTATTCTAAAACGTGG + Intronic
1164151274 19:22553983-22554005 TAACCTACTATGTATAAACAAGG - Intergenic
1166887494 19:45971166-45971188 GCACCTACTACTCTGAGACATGG - Intronic
1168548506 19:57273982-57274004 ACACCTACTATGATGATACAAGG - Intergenic
925955514 2:8960316-8960338 GCATCTACTATGGGCAAACATGG + Intronic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926573809 2:14558725-14558747 GCAACTACTATGTCTAAACATGG + Intergenic
929040433 2:37739147-37739169 GCCCATACTCTTCTTAAACAAGG - Intergenic
931853406 2:66276462-66276484 GCACCTACTCTGCCTCATCACGG + Intergenic
939829137 2:147051688-147051710 GCATCTACTTTTCTGAAACAAGG + Intergenic
940339123 2:152561246-152561268 CCACCTTCTATGCTGAATCAAGG - Intronic
941760495 2:169236966-169236988 ACACCTACCATGTTTAAACAAGG + Intronic
945856673 2:215077066-215077088 GAACCTACTAGGTTTACACAGGG + Intronic
946413551 2:219527591-219527613 GCACCTACTGTGCTTTGACCTGG + Intronic
1169318987 20:4615718-4615740 TGACCTGGTATGCTTAAACATGG - Intergenic
1169660301 20:7971933-7971955 GCACCTACTATCCTACACCAGGG + Intergenic
1170100792 20:12697155-12697177 GCTCCTACTATGCTTATAGATGG + Intergenic
1175718578 20:61271902-61271924 GCACGTGCTATGTTTAAACAAGG + Intronic
1182019838 22:27072246-27072268 GCACCAAGTATGCTTAAAGAGGG - Intergenic
1203292700 22_KI270736v1_random:10692-10714 GCCCATACTCTTCTTAAACAAGG - Intergenic
951669757 3:25167539-25167561 GCACCAGCTATCCTGAAACAAGG + Intergenic
952849536 3:37716154-37716176 GCACCTTCTTTGCATGAACATGG - Intronic
957683344 3:83468985-83469007 GCACCTAATATACCTATACATGG - Intergenic
959184697 3:103031732-103031754 GCACCTACTATGATGTAACAGGG - Intergenic
966905004 3:184515687-184515709 GCAGATACTATGATTATACATGG - Intronic
974336624 4:60555455-60555477 ACACTTCCTATGTTTAAACAGGG - Intergenic
975360381 4:73462781-73462803 GCAACAAATCTGCTTAAACACGG + Intergenic
981877342 4:149563292-149563314 GGACCACCTATTCTTAAACAAGG - Intergenic
982700712 4:158657596-158657618 GCACCTACTGGGCTTGATCAGGG + Intergenic
982967653 4:161934139-161934161 TCACTTACTATGCTTAAGCTGGG - Intronic
986495497 5:8337929-8337951 GCACCCACTGTGCTTACACAGGG + Intergenic
986709737 5:10480086-10480108 GCACCTCCCATGCTCAGACATGG - Intergenic
990069518 5:51763434-51763456 GCACCTACTATGTGTCAACTGGG - Intergenic
995539440 5:113170212-113170234 GCACCTACTTCTTTTAAACAAGG + Intronic
1007872385 6:45054983-45055005 GTTGCTATTATGCTTAAACATGG - Intronic
1007963043 6:45978533-45978555 GGACCTACTGTGTTTTAACAAGG - Intronic
1009914721 6:69979528-69979550 GCAAATACTATTCTTAAAAAGGG + Intronic
1018480635 6:164186028-164186050 GCACCGACTAAGCTAAAATACGG + Intergenic
1019850743 7:3554021-3554043 CCACATACTAAGCCTAAACAGGG + Intronic
1024319688 7:48052472-48052494 GCACTTGCTATGCTTAAAAATGG + Intronic
1024467969 7:49733517-49733539 GCACCTGCTATGCTTACACAAGG + Intergenic
1026323014 7:69283845-69283867 AGACCTCCTATGCATAAACAGGG - Intergenic
1030091378 7:105861883-105861905 GCCCCTACTCTGTTTAAACCTGG + Intronic
1031848806 7:126838497-126838519 CCACCTACTATTCTTTATCAAGG + Intronic
1032189177 7:129753410-129753432 GCAACTCCTATGCTCACACAGGG - Intronic
1032656341 7:133934630-133934652 ACACCTAATATGCATAAAAATGG + Intronic
1039877298 8:41597876-41597898 AGACATTCTATGCTTAAACAAGG - Intronic
1041372183 8:57173219-57173241 GCATCTACTATGGGCAAACACGG - Intergenic
1045166282 8:99609057-99609079 GAAACTACCATGGTTAAACAAGG - Intronic
1047677822 8:127222276-127222298 GTACTTACTATTCTGAAACATGG - Intergenic
1052908572 9:33859438-33859460 TGACCTACTATGTTAAAACAGGG - Intronic
1058235406 9:102484921-102484943 GCACCAACTATGCTGACACTTGG + Intergenic
1186956991 X:14694351-14694373 GCACCTACTATGCTTAAACATGG + Intronic
1188342515 X:29021568-29021590 GAAATTACTGTGCTTAAACAGGG - Intronic
1189906139 X:45761803-45761825 GCACTTAATATCTTTAAACAAGG + Intergenic
1190009124 X:46768017-46768039 GCAGCTACTATCCCTAAACTTGG - Intergenic
1194083302 X:89495114-89495136 CCACCTACCAAGCTTAAACCAGG - Intergenic
1200435953 Y:3150988-3151010 CCACCTACCAAGCTTAAACCAGG - Intergenic