ID: 1186964510

View in Genome Browser
Species Human (GRCh38)
Location X:14772800-14772822
Sequence CTGGTGGCCTGGACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186964502_1186964510 -9 Left 1186964502 X:14772786-14772808 CCAGACCCAAGGCCCTGGTGGCC No data
Right 1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG No data
1186964498_1186964510 8 Left 1186964498 X:14772769-14772791 CCACATAGCTCTGTGTACCAGAC No data
Right 1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG No data
1186964497_1186964510 16 Left 1186964497 X:14772761-14772783 CCACGACTCCACATAGCTCTGTG No data
Right 1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186964510 Original CRISPR CTGGTGGCCTGGACTGAGGA GGG Intergenic
No off target data available for this crispr