ID: 1186975891

View in Genome Browser
Species Human (GRCh38)
Location X:14904543-14904565
Sequence AGGTGCTCAAAATTGCCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186975884_1186975891 12 Left 1186975884 X:14904508-14904530 CCACCCCCATTTCTGACACAAAC 0: 1
1: 0
2: 1
3: 26
4: 290
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 117
1186975887_1186975891 7 Left 1186975887 X:14904513-14904535 CCCATTTCTGACACAAACTGCAA 0: 1
1: 0
2: 3
3: 32
4: 267
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 117
1186975888_1186975891 6 Left 1186975888 X:14904514-14904536 CCATTTCTGACACAAACTGCAAG 0: 1
1: 0
2: 3
3: 29
4: 218
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 117
1186975885_1186975891 9 Left 1186975885 X:14904511-14904533 CCCCCATTTCTGACACAAACTGC 0: 1
1: 0
2: 1
3: 51
4: 223
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 117
1186975883_1186975891 22 Left 1186975883 X:14904498-14904520 CCACACAAGACCACCCCCATTTC 0: 1
1: 2
2: 3
3: 33
4: 211
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 117
1186975886_1186975891 8 Left 1186975886 X:14904512-14904534 CCCCATTTCTGACACAAACTGCA 0: 1
1: 0
2: 18
3: 56
4: 324
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186975891 Original CRISPR AGGTGCTCAAAATTGCCCTT AGG Intronic
900391874 1:2437105-2437127 AGGTGCTCAGTGTTGCCCTGGGG + Intronic
905906352 1:41621053-41621075 GGGTGTTCCCAATTGCCCTTTGG + Intronic
908413035 1:63885716-63885738 AGGTGCCCAGAGATGCCCTTGGG + Intronic
908492220 1:64657080-64657102 AAGTGCTAAAAAATGCACTTGGG - Intronic
911879810 1:103222686-103222708 AGGTCCTAAAAAGTGCACTTAGG - Intergenic
912537793 1:110388546-110388568 AGGTGCTAAAAAGTGCTCTGGGG - Intronic
913085052 1:115429204-115429226 AGGTGCTCAAAGATGCCATCAGG + Intergenic
916869869 1:168901976-168901998 TGGAGCTCAAAATTGCTCTTTGG - Intergenic
920878778 1:209861193-209861215 ATGTCCTCACACTTGCCCTTTGG + Intergenic
1065823403 10:29548060-29548082 AGGTGCTCAAAATGGATCCTTGG + Intronic
1068950122 10:62768423-62768445 AGTTGCTCAAATTTGCCCTTTGG - Intergenic
1069654244 10:70075908-70075930 GGATGCTCCAAATTGCCTTTTGG + Intronic
1073964509 10:108973389-108973411 AGGTGCTCAAAATGGCTTTAAGG - Intergenic
1074216675 10:111391748-111391770 AGGTGCTTAAAATTACCCCCAGG - Intergenic
1074525655 10:114261009-114261031 AGGTTCTCCAAATTGGTCTTTGG + Intronic
1079028445 11:16967418-16967440 AGGTGATTCAAATTGACCTTTGG + Intronic
1079101814 11:17546807-17546829 AGGTGCTCAAAACTGGTCATAGG + Intergenic
1081447523 11:43145149-43145171 AGGTGCTCGACATTGACCTTTGG + Intergenic
1083708840 11:64534988-64535010 AGAGGCTTTAAATTGCCCTTTGG + Intergenic
1088531561 11:110816334-110816356 AGTTCCTCAAAATTACCCTATGG - Intergenic
1095065804 12:37772343-37772365 AGGTGCTCCAACTATCCCTTTGG - Intergenic
1097056502 12:56253180-56253202 AGGTTCTCCAAGGTGCCCTTTGG + Intronic
1097409725 12:59236263-59236285 AGTTAATCAAGATTGCCCTTGGG + Intergenic
1099599876 12:84720813-84720835 AGCTGCACAAAATTACCCCTTGG - Intergenic
1100000765 12:89832547-89832569 AGATGATCAAAATAGCCCCTCGG - Intergenic
1100684307 12:96969525-96969547 ATGTGTTCAACATTGCCTTTAGG - Intergenic
1103599622 12:122046221-122046243 AGGTGCCCAGAGTTGCCCTCAGG - Intronic
1108463894 13:50695238-50695260 AGGTCCTCAAAATTGGTATTGGG - Intronic
1111063853 13:83063871-83063893 ATGTGCTCCGAATTGCCCTGGGG - Intergenic
1112919564 13:104594828-104594850 AGGCACTCATAATTGCCATTTGG - Intergenic
1113519106 13:110925767-110925789 AAGTGCTCAAAAGCACCCTTTGG - Intergenic
1114803375 14:25805196-25805218 ATGGGCTCAAATTTGCCTTTAGG - Intergenic
1118752665 14:68817996-68818018 AGGTGCTTAAAAATGCTCATTGG - Intergenic
1120729280 14:87983929-87983951 AGATCCTCAATATTGCCTTTTGG + Intronic
1122165239 14:99818210-99818232 AGGTGATCAAATCTGCACTTTGG + Intronic
1126412276 15:48384661-48384683 AGGTGCCCACAATTCCCATTTGG + Intergenic
1127322905 15:57864872-57864894 AGGTGCTCAAATTGACACTTTGG + Intergenic
1128779455 15:70349318-70349340 AGGTGGAGAAATTTGCCCTTAGG + Intergenic
1130627178 15:85527367-85527389 AGGGGGTGAAAATTGCCTTTTGG + Intronic
1130890906 15:88133144-88133166 TGGTTCTCAAAAGTGACCTTTGG - Intronic
1130967900 15:88710662-88710684 AGGTGCTCTAAATTGGCTTGGGG + Intergenic
1134068508 16:11245979-11246001 AGGTGATCAAATTTGCAATTTGG + Intergenic
1134591458 16:15457501-15457523 AGGAGCTCACCATTGCCTTTGGG + Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1135937306 16:26792290-26792312 AGGTGTTCAAAAATGTCCTCAGG - Intergenic
1136466985 16:30451093-30451115 TGCTGCTCTCAATTGCCCTTTGG + Intergenic
1144940272 17:18934225-18934247 AGCTGCTAAAAAATGCCATTGGG - Intergenic
1148080843 17:44967142-44967164 AGGTGCACGGACTTGCCCTTGGG - Intronic
1149574750 17:57703544-57703566 AGGTTCTCAACATTGGCATTTGG + Intergenic
1150505513 17:65694186-65694208 AGGTTCTAAAACCTGCCCTTTGG + Intronic
1151451705 17:74202060-74202082 AAGTGCCCAAAAGTGCCCCTCGG + Intergenic
1157980673 18:52376269-52376291 AGGTGCAGAAAATAGCACTTTGG + Intronic
1159829509 18:73257622-73257644 AGATGCTCAAATGTGCCCTTAGG + Intronic
1159829645 18:73259226-73259248 AGATGCTCAAATGTGCCCTTAGG - Intronic
1161478750 19:4500193-4500215 AGGTGCTCAGAGCAGCCCTTTGG + Intronic
1161522200 19:4730888-4730910 AGGTGCTCAAAAGCACCCTCTGG - Intergenic
1162829661 19:13276399-13276421 AGGTGTTCACAGGTGCCCTTTGG - Intronic
1164571380 19:29377062-29377084 AGGGGCTCAAAATGTCCCTCTGG - Intergenic
1164572381 19:29383783-29383805 AGGTGCTTAAAGATGCCATTGGG + Intergenic
934724269 2:96605255-96605277 AGGTACACAGCATTGCCCTTTGG - Intronic
935077599 2:99760882-99760904 AGGTCCTCAGTTTTGCCCTTGGG + Intronic
936391508 2:112078668-112078690 AGGGGCTCAAAACTGCCCGCTGG - Intronic
937698529 2:124836995-124837017 AGGTGCTGACTCTTGCCCTTGGG - Intronic
944464790 2:199990168-199990190 AGGTGCTCAAAGTTGTTCTTTGG + Intronic
945974593 2:216260365-216260387 AGGTGCTGACAATTGCCTTAAGG + Intronic
947575155 2:231267548-231267570 AGCAGCTCACCATTGCCCTTAGG - Intronic
1172420419 20:34812311-34812333 AGCTGCACAAATTTTCCCTTGGG - Intronic
1172814803 20:37677956-37677978 AGTTTCTCAACTTTGCCCTTTGG + Intergenic
1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG + Intronic
1177700034 21:24626853-24626875 AGGTGCTTTAAATTTACCTTTGG + Intergenic
1180065765 21:45411432-45411454 AGGTGCTCAAAAATGCACACAGG - Intronic
1183644764 22:39118356-39118378 AGGTACTCAAACCTACCCTTTGG + Intergenic
1184606648 22:45578284-45578306 AGGTGCTATAAATGGCTCTTTGG - Intronic
1185058803 22:48594894-48594916 TGGTGCTCAGAGTAGCCCTTGGG + Intronic
950434257 3:12968948-12968970 AGGTGCTCTAAACTGGCTTTAGG - Intronic
951375363 3:21908406-21908428 AGGTGCCCAGAATTGCTTTTTGG - Intronic
954570918 3:51640091-51640113 AGGTCCTCACAATAGCACTTGGG - Intronic
955060769 3:55489696-55489718 AGGTTCTCAAAGCTCCCCTTGGG + Intronic
955776849 3:62442661-62442683 AGATGCACATAATTGACCTTGGG + Intronic
956576521 3:70758266-70758288 AGGTCCCCAAAATTACCCTGTGG + Intergenic
958065324 3:88537752-88537774 AGGTGCTCAATAGTGCTTTTTGG + Intergenic
958350923 3:92809666-92809688 AGGTGCTTGAAATTTCCCCTTGG - Intergenic
959869010 3:111304999-111305021 AGCTGCTGTAAATTACCCTTTGG + Intronic
960647774 3:119908382-119908404 AGGGGCTGAAATTTGCTCTTGGG + Intronic
962089618 3:132229701-132229723 AGGTGTTCAAAATTGAGTTTTGG - Intronic
965998214 3:174913042-174913064 AGTACCTCAAAATTGCCTTTGGG + Intronic
971482191 4:27124850-27124872 AGGGGCTCAAAGATGCTCTTGGG + Intergenic
975958535 4:79872678-79872700 ATGTGCTCAGAATTGCCCTCTGG - Intergenic
976547581 4:86355334-86355356 AGGTGCTCACAATTACTCCTAGG + Intronic
982641241 4:157964286-157964308 TGGTGCACATATTTGCCCTTTGG - Intergenic
983324223 4:166232802-166232824 GGGTTCCCAAAACTGCCCTTAGG + Intergenic
986266870 5:6198216-6198238 AGCTGCTGAAAAATGACCTTTGG - Intergenic
987083223 5:14445106-14445128 AGGTGCTCAAAGTTGGCCTCAGG + Intronic
987522744 5:19007986-19008008 AGGTGTTCAAAAATGCTCATTGG + Intergenic
988247536 5:28706826-28706848 AAGTCCTCAAAATTGTCTTTGGG - Intergenic
989260406 5:39413169-39413191 AGTTGCACAGACTTGCCCTTTGG + Intronic
991202217 5:64007832-64007854 AGGTGGTCAAAACTGCCTCTGGG - Intergenic
998588902 5:143456658-143456680 ACTTGCTTAAAATTCCCCTTTGG + Intergenic
1002883443 6:1273091-1273113 ATGTGCTCAAAACTGCCTGTGGG + Intergenic
1002993402 6:2258818-2258840 ACCTTCTCAGAATTGCCCTTAGG - Intergenic
1003153451 6:3571822-3571844 AGCTGCTCAAAGGTGCCCTGTGG - Intergenic
1004512208 6:16292197-16292219 AGGTCCTCAAAATGACCCTCTGG - Intronic
1010952247 6:82050527-82050549 AGGTGCTCAACATTGTCTTGGGG - Intergenic
1012705671 6:102525851-102525873 AGATGCTAAAAATTGCCCCATGG - Intergenic
1017268287 6:152477128-152477150 AGGCTCTCAAAATTGCAATTGGG - Intronic
1021586703 7:22216300-22216322 AGGAGCTTAAACTTGCCTTTTGG - Intronic
1021830709 7:24605019-24605041 GGGTGCTGAAAATTGCCCAAAGG - Intronic
1023515663 7:40998691-40998713 GGATGCTCAAAATATCCCTTGGG - Intergenic
1024546069 7:50519906-50519928 CTGTGCTGAAAATTGGCCTTAGG - Intronic
1025518578 7:61688352-61688374 AAGTGCTCCAAATATCCCTTTGG + Intergenic
1025518595 7:61688691-61688713 AGGTGCTCCAAATATCCCTTTGG + Intergenic
1025542860 7:62116317-62116339 AAGCGCTCAAAATATCCCTTTGG + Intergenic
1025542920 7:62117338-62117360 AGGTGCTCCAAATATCCCTTTGG + Intergenic
1026477410 7:70748946-70748968 AGGTGCTCACAGTTGTACTTGGG + Intronic
1029826005 7:103195230-103195252 AGGAGTACAAAATTGCCTTTTGG + Intergenic
1033114143 7:138610541-138610563 ACGTGGTCAAAATTGCCCTTGGG + Intronic
1047234150 8:123024382-123024404 GTGAGCTCAAAATTGCCTTTGGG - Intronic
1047715138 8:127588400-127588422 AAGTGATCAAAATTGCACTTAGG + Intergenic
1047758349 8:127935736-127935758 AAATGGTCAAAATGGCCCTTTGG - Intergenic
1048906546 8:139094683-139094705 AGAAGCTCAAAGTGGCCCTTGGG + Intergenic
1053225228 9:36349369-36349391 AGGTGCTCAACATTGCAATCAGG - Intronic
1054713137 9:68531220-68531242 AGTTACTCAAAACTGCCTTTGGG + Intergenic
1057609152 9:96525394-96525416 GGGGTCTCTAAATTGCCCTTGGG - Intronic
1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG + Intronic
1188782089 X:34297717-34297739 AAGTGATCAAAAATGCCCTTTGG + Intergenic
1191240251 X:58183695-58183717 AGGGGCTCAGAAATGTCCTTTGG - Intergenic
1192893166 X:75411692-75411714 AGGAACTCAAAATTGCACTGTGG - Intronic
1197536651 X:127697038-127697060 AGTTTCTAAAAATTGCCCATAGG - Intergenic
1199516651 X:148684587-148684609 AACTGCTCAAAATAGCACTTAGG + Intronic
1200423742 Y:2999940-2999962 AGTTGCTCACAATCCCCCTTTGG - Intergenic
1201925728 Y:19285564-19285586 GAGTACTCAAAATTGTCCTTGGG - Intergenic