ID: 1186975891

View in Genome Browser
Species Human (GRCh38)
Location X:14904543-14904565
Sequence AGGTGCTCAAAATTGCCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186975885_1186975891 9 Left 1186975885 X:14904511-14904533 CCCCCATTTCTGACACAAACTGC No data
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG No data
1186975887_1186975891 7 Left 1186975887 X:14904513-14904535 CCCATTTCTGACACAAACTGCAA No data
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG No data
1186975883_1186975891 22 Left 1186975883 X:14904498-14904520 CCACACAAGACCACCCCCATTTC No data
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG No data
1186975888_1186975891 6 Left 1186975888 X:14904514-14904536 CCATTTCTGACACAAACTGCAAG No data
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG No data
1186975884_1186975891 12 Left 1186975884 X:14904508-14904530 CCACCCCCATTTCTGACACAAAC No data
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG No data
1186975886_1186975891 8 Left 1186975886 X:14904512-14904534 CCCCATTTCTGACACAAACTGCA No data
Right 1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186975891 Original CRISPR AGGTGCTCAAAATTGCCCTT AGG Intronic