ID: 1186976817

View in Genome Browser
Species Human (GRCh38)
Location X:14916467-14916489
Sequence AGACCTGGTGTTGCTCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186976812_1186976817 9 Left 1186976812 X:14916435-14916457 CCTGCAAGGCTCTGGGGATGCCC 0: 1
1: 0
2: 3
3: 29
4: 251
Right 1186976817 X:14916467-14916489 AGACCTGGTGTTGCTCAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 118
1186976811_1186976817 10 Left 1186976811 X:14916434-14916456 CCCTGCAAGGCTCTGGGGATGCC 0: 1
1: 0
2: 7
3: 40
4: 330
Right 1186976817 X:14916467-14916489 AGACCTGGTGTTGCTCAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186976817 Original CRISPR AGACCTGGTGTTGCTCAAGG AGG Intronic
904834323 1:33324948-33324970 AGCCCTGCTGCTGCTCAAGGAGG - Exonic
904968914 1:34403500-34403522 ACTCCAGGTGTGGCTCAAGGGGG - Intergenic
907419498 1:54337301-54337323 GGACCTGGTGTTGCAGAAGCTGG + Intronic
909451224 1:75799753-75799775 AGACCTGGTGTTGAATATGGGGG - Intronic
910629426 1:89340462-89340484 AGCCCTGGTGTTCCAAAAGGAGG - Intergenic
915073977 1:153294015-153294037 AGACCTGGTGATGAGCAGGGAGG - Intergenic
915428312 1:155845380-155845402 GGACCTGGTGGTGCAGAAGGTGG + Intronic
915825361 1:159070074-159070096 AGAGTTGGTGTTGGTCAAAGCGG - Intronic
919990341 1:202704867-202704889 AGAGCAGGTGTTCCTGAAGGAGG + Intronic
921974376 1:221186243-221186265 AGACAGGGTGTTGCCCAAGCTGG + Intergenic
1066159148 10:32710090-32710112 AGAATAGGTTTTGCTCAAGGAGG - Intronic
1067346355 10:45441612-45441634 AGACCTGGTGGTGCGCCTGGAGG - Intronic
1068554292 10:58440635-58440657 AGATCGGTAGTTGCTCAAGGAGG - Intergenic
1068693212 10:59939307-59939329 TGACCTGGTGTTCCTCATGTTGG + Intergenic
1070657830 10:78283365-78283387 AGACCTGGAGCTGCTGCAGGTGG + Intergenic
1070850540 10:79558972-79558994 GGACATGGTGTTTCTCCAGGCGG + Exonic
1071282566 10:84115850-84115872 AGTCCTGGTGGTACTCCAGGTGG - Intergenic
1075294971 10:121267091-121267113 AGAGCAGGTGTTGCTGCAGGGGG + Intergenic
1075569666 10:123530677-123530699 ATACCTGGGGTTCCACAAGGTGG - Intergenic
1081543349 11:44051921-44051943 AGACATGGTGGACCTCAAGGAGG + Intronic
1092770757 12:11894435-11894457 CGACTTGGTTTTGCTTAAGGTGG + Exonic
1095359323 12:41317301-41317323 AGAGTTGATGTTGCTCAAGTTGG + Intronic
1101159726 12:101961182-101961204 AGACTTGGCCTTGCTGAAGGTGG + Intronic
1101514007 12:105417994-105418016 AGACTTGGTGGTGCTAAGGGTGG + Intergenic
1107045902 13:35991785-35991807 AGACCTGGATTTGCTAATGGGGG - Intronic
1108946475 13:56031906-56031928 AGACCTGGTGAGACTGAAGGGGG + Intergenic
1112545832 13:100369400-100369422 AGACCTGGTGTGGCTTGAGAGGG + Intronic
1113642735 13:111969783-111969805 AGTCCTGGGGTTGCTCACGCAGG + Intergenic
1113752996 13:112789279-112789301 ACACCTGGTGTGGATTAAGGAGG - Intronic
1121537823 14:94703258-94703280 TGAGCTGGAGTTGCTCAAGATGG - Intergenic
1122685587 14:103504059-103504081 AGACCTGGTGTTTCTCCATAGGG - Intergenic
1123028260 14:105438749-105438771 GGCCCTGGTGTTGCTGCAGGGGG + Intronic
1125756934 15:42070792-42070814 AGAGCTGGTGTTGATGAAGTAGG + Exonic
1127010631 15:54622935-54622957 AGCCCTAGTTTTGCTCAAAGTGG - Intronic
1128741682 15:70088220-70088242 GGACCTTGCGTTTCTCAAGGAGG - Intronic
1130983848 15:88831796-88831818 AGACCTTCTGTGGCTCCAGGGGG + Intronic
1132892223 16:2210015-2210037 AGACCTGGTGCTCCTCAGGGCGG + Exonic
1132992560 16:2804431-2804453 ACACCTGGTGTTGTTTAAGATGG - Intergenic
1141256996 16:82411703-82411725 AAACCTTTTCTTGCTCAAGGTGG + Intergenic
1141696568 16:85622933-85622955 AGACCTGGTGTTGAGGAAGCTGG + Intronic
1142177491 16:88651744-88651766 AGACCTGGGGTTGCTCCTGAGGG + Intergenic
1149412471 17:56422923-56422945 AGTCCTGGTGCTGCCCTAGGAGG + Intronic
1150282899 17:63939842-63939864 AGCCCTGGTGGTGCTCACGGAGG + Exonic
1151535528 17:74737039-74737061 CGAGCCGGTGTTGCTCAGGGAGG + Exonic
1152615478 17:81335985-81336007 AGAGCTGGGCATGCTCAAGGAGG - Intergenic
1152702039 17:81824065-81824087 AGACCTGGTTCTGATCATGGGGG - Intronic
1152895102 17:82906332-82906354 AGACCAGGAGGTGCACAAGGAGG - Intronic
1154163290 18:11995689-11995711 AGATCTGGTCTAGCTCCAGGAGG + Intronic
1158832123 18:61290939-61290961 ATACCTGTTTTTGCTCTAGGGGG + Intergenic
1159047488 18:63383102-63383124 AGACCTGGGGTTGCTCCAAGTGG - Intergenic
1161949896 19:7462189-7462211 AGATCTGCTGTTTCTCTAGGAGG - Exonic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
926615875 2:14996000-14996022 AGGCCTGGTGATGCTGGAGGTGG - Intergenic
926826421 2:16909967-16909989 AAACCCTGTGTTGTTCAAGGGGG - Intergenic
931803203 2:65778694-65778716 AGACCTGGTCTGGCTCAGGGTGG + Intergenic
932756376 2:74412778-74412800 AGACCTTGTCTCCCTCAAGGTGG - Intergenic
936576986 2:113665486-113665508 AGAGCTGGTGCTGCTGAAGTTGG - Intergenic
937128885 2:119491914-119491936 GGACCTGGTTTTGCTCCAGGTGG + Intronic
937148895 2:119672362-119672384 TGACCTGGTGTTTCCCCAGGTGG - Intergenic
937589524 2:123596331-123596353 AGACCTGGTGTTCTACAAAGTGG + Intergenic
938032315 2:128005583-128005605 AGACCTAGTCTTGCTCAGGCTGG - Intronic
938375522 2:130803252-130803274 AGATCTAGTGGTGCTCAAGGTGG + Intergenic
940599647 2:155842580-155842602 TGCCCTGGCTTTGCTCAAGGAGG - Intergenic
944667998 2:201972730-201972752 TTACCTGGTGTTGCTCTGGGAGG - Intergenic
946213959 2:218169099-218169121 GGCCCTGGTCTTTCTCAAGGGGG - Intergenic
1169963840 20:11193151-11193173 ACAACTGGTGTAGCTCAAGTAGG - Intergenic
1170873984 20:20233844-20233866 AGGCCTAATGTTGCTCAAAGTGG - Intronic
1179500758 21:41807020-41807042 GGACCTGGTGTTGGTGATGGTGG - Intronic
1181980252 22:26761064-26761086 AGAGATGGTGTTGATGAAGGAGG + Intergenic
1182654833 22:31881562-31881584 AGCCCTGGTAGTGCTCTAGGTGG - Intronic
1182864882 22:33595378-33595400 AGACCAACTGTAGCTCAAGGTGG + Intronic
1183484238 22:38080873-38080895 GGGCCTGGTGTTGCTCGTGGAGG - Exonic
1185423256 22:50747188-50747210 AGAGCTGGTGCTGCTGAAGTTGG + Intergenic
958677141 3:97279644-97279666 AAACCTGGTTATGATCAAGGTGG + Intronic
959580518 3:107978195-107978217 AGACTTGGTGTGGATCTAGGAGG - Intergenic
960579030 3:119257990-119258012 AGATCTGGTGTTGTTAAGGGAGG - Intergenic
962527532 3:136250205-136250227 AGACCCGGTGCTGCCCGAGGAGG - Intergenic
962626656 3:137232031-137232053 AGGCTTGGTCCTGCTCAAGGAGG + Intergenic
962897005 3:139724613-139724635 AGACCTGGTGGTGTTCATTGCGG + Intergenic
963232736 3:142925280-142925302 AGACCTGGTAGTGCTCCTGGAGG + Intergenic
964119966 3:153173291-153173313 AGACCTTGTGTGGATGAAGGAGG + Intergenic
964821249 3:160772421-160772443 GGACCTGTTTTTGCTAAAGGAGG - Intronic
972855955 4:43106818-43106840 AGACCTGGAGATGTTTAAGGAGG - Intergenic
974848345 4:67378707-67378729 AGATCAGGTGTTGCCCAAAGAGG - Intergenic
976698098 4:87939555-87939577 AGATCTGGTCTTGCTCCAGGAGG + Intergenic
980167789 4:129250145-129250167 AGAGCTGGTGTCACTCAGGGTGG + Intergenic
983284670 4:165724384-165724406 AGACTTGGTGTGGGTCAGGGTGG - Intergenic
983935451 4:173499896-173499918 AGACCCGGTGTTGCTCAATATGG - Intergenic
984892619 4:184507172-184507194 ATTCCTTGTTTTGCTCAAGGTGG + Intergenic
985824524 5:2182392-2182414 ACACCTGTTTTTGCTCAAGGCGG + Intergenic
986408677 5:7453432-7453454 AGAACTGTTGTTGCTGAAGGTGG - Intronic
988922072 5:35952613-35952635 AGACCTTATGTTGCTCATGAGGG + Exonic
993937504 5:94022162-94022184 AGTCTTGCTGTTGCTCAAGCTGG - Intronic
993996281 5:94727377-94727399 AGACCTTGGTTTGCTGAAGGTGG - Intronic
998003413 5:138641831-138641853 AGAGCTGGACTTCCTCAAGGGGG - Intronic
1001450472 5:171820689-171820711 GGACCTGCTGTTGCTCAATCTGG - Intergenic
1001666424 5:173437107-173437129 AGACCTGCTGCTGCTGAATGCGG + Intergenic
1002315792 5:178342222-178342244 AGACCTGCTGGAGCTCCAGGTGG - Intronic
1005221613 6:23594526-23594548 AGACCTGCTGCTGCACAATGAGG - Intergenic
1006377996 6:33682461-33682483 GGACCTGGGGTTGCCCAGGGTGG + Intronic
1007064177 6:38972741-38972763 AAACATGGTGTCCCTCAAGGCGG - Intronic
1012515404 6:100053306-100053328 AAACCTGGTGTGGGACAAGGGGG + Intergenic
1015866964 6:137736889-137736911 GAACTTGGTCTTGCTCAAGGCGG - Intergenic
1017826682 6:158086862-158086884 GGACCTGGTGGAGCTCAAGCGGG + Exonic
1017949804 6:159127218-159127240 AGACCTGGTGTCGCTGATGCAGG - Intergenic
1019526268 7:1481811-1481833 AGACCTGGGGCCGCACAAGGGGG + Intronic
1021093042 7:16505230-16505252 AGGCCTGGTGGTCTTCAAGGGGG + Intronic
1021714748 7:23451562-23451584 TTAGCTGTTGTTGCTCAAGGTGG - Intronic
1023824713 7:44001247-44001269 AGTCCTTGTGGTGCTCAAGGAGG - Exonic
1023984571 7:45087425-45087447 AGGCCAGGTCTTGCCCAAGGTGG + Intronic
1025150177 7:56541323-56541345 AGACCTGGGGTGGCTGGAGGTGG - Intergenic
1026088263 7:67279999-67280021 AGTCCTTGTGGTGCTCAGGGAGG - Intergenic
1026725992 7:72870328-72870350 AGTCCTTGTGGTGCTCAGGGAGG + Intergenic
1027117864 7:75495337-75495359 AGCCCTTGTGGTGCTCAGGGAGG - Intergenic
1027273943 7:76540143-76540165 AGTCCTTGTGGTGCTCAGGGAGG + Intergenic
1027327388 7:77059195-77059217 AGTCCTTGTGGTGCTCAGGGAGG + Intergenic
1029719636 7:102354718-102354740 AGTCCTTGTGGTGCTCAGGGAGG + Intergenic
1029752979 7:102554540-102554562 AGTCCTTGTGGTGCTCAGGGAGG - Exonic
1029770929 7:102653632-102653654 AGTCCTTGTGGTGCTCAGGGAGG - Exonic
1035894595 8:3384336-3384358 AGACATAGTGTTGCTCAAATTGG - Intronic
1037646689 8:20798964-20798986 AGAGGTGGTGTTGCTCACTGGGG - Intergenic
1038532683 8:28331347-28331369 AGGGCTGGTGTTCCTGAAGGAGG - Intronic
1042810479 8:72820132-72820154 AGGCTTGGTGCTGCTCAAAGGGG - Intronic
1052390898 9:27877943-27877965 TCACCTGGAGTTGCTCAAAGGGG + Intergenic
1060121298 9:120992909-120992931 AGGCTTGTTGTTGCTCAAAGAGG + Intronic
1061641142 9:131957280-131957302 AGACAGGGTGTTGCTCAGGCTGG + Intronic
1186300867 X:8198372-8198394 AAACCAGGTGTTGCTTGAGGTGG - Intergenic
1186976817 X:14916467-14916489 AGACCTGGTGTTGCTCAAGGAGG + Intronic
1191893645 X:65970788-65970810 AAACCTGGTGTTGTTCAAGTAGG - Intergenic
1191903600 X:66064535-66064557 AGACTTGGGGTTGCTAGAGGGGG - Intergenic
1199218256 X:145286220-145286242 AAACCTACTTTTGCTCAAGGTGG + Intergenic
1202603536 Y:26618723-26618745 AGCCCTGGTGTGGCTTTAGGGGG + Intergenic