ID: 1186979072

View in Genome Browser
Species Human (GRCh38)
Location X:14939702-14939724
Sequence TTGGCTACACAGAATTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186979072_1186979080 5 Left 1186979072 X:14939702-14939724 CCCAGGTAATTCTGTGTAGCCAA No data
Right 1186979080 X:14939730-14939752 AGAACCAGTGGGTTATCCCGGGG No data
1186979072_1186979078 3 Left 1186979072 X:14939702-14939724 CCCAGGTAATTCTGTGTAGCCAA No data
Right 1186979078 X:14939728-14939750 TCAGAACCAGTGGGTTATCCCGG No data
1186979072_1186979084 23 Left 1186979072 X:14939702-14939724 CCCAGGTAATTCTGTGTAGCCAA No data
Right 1186979084 X:14939748-14939770 CGGGGTTCCTTAACTGCAGAAGG No data
1186979072_1186979076 -6 Left 1186979072 X:14939702-14939724 CCCAGGTAATTCTGTGTAGCCAA No data
Right 1186979076 X:14939719-14939741 AGCCAAGGTTCAGAACCAGTGGG No data
1186979072_1186979079 4 Left 1186979072 X:14939702-14939724 CCCAGGTAATTCTGTGTAGCCAA No data
Right 1186979079 X:14939729-14939751 CAGAACCAGTGGGTTATCCCGGG No data
1186979072_1186979075 -7 Left 1186979072 X:14939702-14939724 CCCAGGTAATTCTGTGTAGCCAA No data
Right 1186979075 X:14939718-14939740 TAGCCAAGGTTCAGAACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186979072 Original CRISPR TTGGCTACACAGAATTACCT GGG (reversed) Intergenic
No off target data available for this crispr