ID: 1186979503

View in Genome Browser
Species Human (GRCh38)
Location X:14944209-14944231
Sequence AATGCAGCTCGTTCTCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186979501_1186979503 -8 Left 1186979501 X:14944194-14944216 CCAAATAACAGAATGAATGCAGC No data
Right 1186979503 X:14944209-14944231 AATGCAGCTCGTTCTCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186979503 Original CRISPR AATGCAGCTCGTTCTCAGGA TGG Intergenic
No off target data available for this crispr