ID: 1186989831

View in Genome Browser
Species Human (GRCh38)
Location X:15055529-15055551
Sequence GCCTTCATCTAAAGTAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186989829_1186989831 2 Left 1186989829 X:15055504-15055526 CCTGAGGATACCAGGAACAACAG No data
Right 1186989831 X:15055529-15055551 GCCTTCATCTAAAGTAGAGTTGG No data
1186989826_1186989831 10 Left 1186989826 X:15055496-15055518 CCCAAGGGCCTGAGGATACCAGG No data
Right 1186989831 X:15055529-15055551 GCCTTCATCTAAAGTAGAGTTGG No data
1186989830_1186989831 -8 Left 1186989830 X:15055514-15055536 CCAGGAACAACAGCTGCCTTCAT No data
Right 1186989831 X:15055529-15055551 GCCTTCATCTAAAGTAGAGTTGG No data
1186989828_1186989831 9 Left 1186989828 X:15055497-15055519 CCAAGGGCCTGAGGATACCAGGA No data
Right 1186989831 X:15055529-15055551 GCCTTCATCTAAAGTAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186989831 Original CRISPR GCCTTCATCTAAAGTAGAGT TGG Intergenic
No off target data available for this crispr