ID: 1186995825

View in Genome Browser
Species Human (GRCh38)
Location X:15121052-15121074
Sequence CATTTCTACCAGAGTGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186995825_1186995828 3 Left 1186995825 X:15121052-15121074 CCAAGTACACTCTGGTAGAAATG No data
Right 1186995828 X:15121078-15121100 AGGAAGGTGATGTTCAAATCTGG No data
1186995825_1186995829 4 Left 1186995825 X:15121052-15121074 CCAAGTACACTCTGGTAGAAATG No data
Right 1186995829 X:15121079-15121101 GGAAGGTGATGTTCAAATCTGGG No data
1186995825_1186995830 5 Left 1186995825 X:15121052-15121074 CCAAGTACACTCTGGTAGAAATG No data
Right 1186995830 X:15121080-15121102 GAAGGTGATGTTCAAATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186995825 Original CRISPR CATTTCTACCAGAGTGTACT TGG (reversed) Intergenic
No off target data available for this crispr