ID: 1186995958

View in Genome Browser
Species Human (GRCh38)
Location X:15122683-15122705
Sequence GATACTCTGGATTTGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186995952_1186995958 8 Left 1186995952 X:15122652-15122674 CCTCAGTCCTTCTACTACCAGCA No data
Right 1186995958 X:15122683-15122705 GATACTCTGGATTTGGCACAGGG No data
1186995949_1186995958 27 Left 1186995949 X:15122633-15122655 CCTATGTTTTTAGATCCCTCCTC No data
Right 1186995958 X:15122683-15122705 GATACTCTGGATTTGGCACAGGG No data
1186995951_1186995958 11 Left 1186995951 X:15122649-15122671 CCTCCTCAGTCCTTCTACTACCA No data
Right 1186995958 X:15122683-15122705 GATACTCTGGATTTGGCACAGGG No data
1186995947_1186995958 29 Left 1186995947 X:15122631-15122653 CCCCTATGTTTTTAGATCCCTCC No data
Right 1186995958 X:15122683-15122705 GATACTCTGGATTTGGCACAGGG No data
1186995953_1186995958 1 Left 1186995953 X:15122659-15122681 CCTTCTACTACCAGCACTACTAC No data
Right 1186995958 X:15122683-15122705 GATACTCTGGATTTGGCACAGGG No data
1186995954_1186995958 -9 Left 1186995954 X:15122669-15122691 CCAGCACTACTACTGATACTCTG No data
Right 1186995958 X:15122683-15122705 GATACTCTGGATTTGGCACAGGG No data
1186995948_1186995958 28 Left 1186995948 X:15122632-15122654 CCCTATGTTTTTAGATCCCTCCT No data
Right 1186995958 X:15122683-15122705 GATACTCTGGATTTGGCACAGGG No data
1186995950_1186995958 12 Left 1186995950 X:15122648-15122670 CCCTCCTCAGTCCTTCTACTACC 0: 3
1: 0
2: 0
3: 27
4: 269
Right 1186995958 X:15122683-15122705 GATACTCTGGATTTGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186995958 Original CRISPR GATACTCTGGATTTGGCACA GGG Intergenic
No off target data available for this crispr