ID: 1186997562

View in Genome Browser
Species Human (GRCh38)
Location X:15139968-15139990
Sequence TTTCCAGATTTTGAAGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186997562_1186997563 17 Left 1186997562 X:15139968-15139990 CCAATAGCTTCAAAATCTGGAAA No data
Right 1186997563 X:15140008-15140030 AAGAATAAAGATGAATAAGCAGG No data
1186997562_1186997565 21 Left 1186997562 X:15139968-15139990 CCAATAGCTTCAAAATCTGGAAA No data
Right 1186997565 X:15140012-15140034 ATAAAGATGAATAAGCAGGAGGG No data
1186997562_1186997566 22 Left 1186997562 X:15139968-15139990 CCAATAGCTTCAAAATCTGGAAA No data
Right 1186997566 X:15140013-15140035 TAAAGATGAATAAGCAGGAGGGG No data
1186997562_1186997564 20 Left 1186997562 X:15139968-15139990 CCAATAGCTTCAAAATCTGGAAA No data
Right 1186997564 X:15140011-15140033 AATAAAGATGAATAAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186997562 Original CRISPR TTTCCAGATTTTGAAGCTAT TGG (reversed) Intergenic
No off target data available for this crispr