ID: 1186997565

View in Genome Browser
Species Human (GRCh38)
Location X:15140012-15140034
Sequence ATAAAGATGAATAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186997562_1186997565 21 Left 1186997562 X:15139968-15139990 CCAATAGCTTCAAAATCTGGAAA No data
Right 1186997565 X:15140012-15140034 ATAAAGATGAATAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186997565 Original CRISPR ATAAAGATGAATAAGCAGGA GGG Intergenic
No off target data available for this crispr