ID: 1187003493

View in Genome Browser
Species Human (GRCh38)
Location X:15206679-15206701
Sequence TCTGATAAGGAGCTAATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187003493_1187003497 17 Left 1187003493 X:15206679-15206701 CCCTGTATTAGCTCCTTATCAGA No data
Right 1187003497 X:15206719-15206741 TAAGCAAAATCAGTTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187003493 Original CRISPR TCTGATAAGGAGCTAATACA GGG (reversed) Intergenic
No off target data available for this crispr