ID: 1187003497

View in Genome Browser
Species Human (GRCh38)
Location X:15206719-15206741
Sequence TAAGCAAAATCAGTTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187003492_1187003497 18 Left 1187003492 X:15206678-15206700 CCCCTGTATTAGCTCCTTATCAG No data
Right 1187003497 X:15206719-15206741 TAAGCAAAATCAGTTCTCACAGG No data
1187003495_1187003497 4 Left 1187003495 X:15206692-15206714 CCTTATCAGACTCAAACCTGCAC No data
Right 1187003497 X:15206719-15206741 TAAGCAAAATCAGTTCTCACAGG No data
1187003494_1187003497 16 Left 1187003494 X:15206680-15206702 CCTGTATTAGCTCCTTATCAGAC No data
Right 1187003497 X:15206719-15206741 TAAGCAAAATCAGTTCTCACAGG No data
1187003493_1187003497 17 Left 1187003493 X:15206679-15206701 CCCTGTATTAGCTCCTTATCAGA No data
Right 1187003497 X:15206719-15206741 TAAGCAAAATCAGTTCTCACAGG No data
1187003491_1187003497 19 Left 1187003491 X:15206677-15206699 CCCCCTGTATTAGCTCCTTATCA No data
Right 1187003497 X:15206719-15206741 TAAGCAAAATCAGTTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187003497 Original CRISPR TAAGCAAAATCAGTTCTCAC AGG Intergenic
No off target data available for this crispr