ID: 1187007646

View in Genome Browser
Species Human (GRCh38)
Location X:15248117-15248139
Sequence GGAACAAAGACACCTCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187007646_1187007647 -8 Left 1187007646 X:15248117-15248139 CCAACTTGAGGTGTCTTTGTTCC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1187007647 X:15248132-15248154 TTTGTTCCCCAGCCCAGCCCAGG 0: 1
1: 0
2: 4
3: 28
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187007646 Original CRISPR GGAACAAAGACACCTCAAGT TGG (reversed) Intronic
900306900 1:2014558-2014580 GGCACGAAGACGCCTAAAGTGGG - Intergenic
900735618 1:4297809-4297831 GGAACCCAGAGACCTCCAGTGGG + Intergenic
904412730 1:30334877-30334899 GCAACAAAGACACCAGGAGTGGG + Intergenic
906227440 1:44133421-44133443 GGAAGAAAGACTTCTCAAGGAGG + Exonic
910367145 1:86478126-86478148 GGCATAAAGAGACATCAAGTGGG + Intronic
915158915 1:153902381-153902403 GGAACAAGTACCCCTTAAGTAGG - Intronic
920076548 1:203341476-203341498 GGGCCAAACACACCTCAAATTGG - Exonic
921927806 1:220726959-220726981 GGAAAACAGACACCTAGAGTGGG - Intergenic
923219893 1:231883517-231883539 GGCACACAGACTCCTCATGTGGG - Intronic
923393383 1:233536011-233536033 GGAAGAAAGAGACCTCACCTTGG - Intergenic
1063617727 10:7616143-7616165 GGAGCAAAAATACCTGAAGTGGG + Intronic
1063674930 10:8132348-8132370 GGAACAAAGAAACCTGTAATGGG - Intergenic
1064940979 10:20735226-20735248 GGAAAAAAATGACCTCAAGTTGG + Intergenic
1065419879 10:25531300-25531322 GGAAAAGAGAAACATCAAGTAGG + Intronic
1070491982 10:76985984-76986006 GAAACAAATAAACCTCAAATGGG + Intronic
1073379379 10:103066314-103066336 GGAACAGGGACACCACGAGTGGG - Intronic
1076426477 10:130370902-130370924 CAAACATAGACACCTCAAGGGGG - Intergenic
1077662452 11:4081952-4081974 GGAACAGAAACATCTCAATTTGG + Intronic
1080776838 11:35394268-35394290 GGATCAAAGACACATCAAAACGG + Intronic
1081634257 11:44710433-44710455 GGAACAAACAAATCTCTAGTTGG + Intergenic
1082736851 11:56865572-56865594 GCCACAAAGATAGCTCAAGTTGG - Intergenic
1085434711 11:76489903-76489925 GAAAAAAAGATACATCAAGTAGG - Intronic
1086171334 11:83839926-83839948 GGATCAAGGAGACTTCAAGTTGG - Intronic
1086442131 11:86838723-86838745 GGAGCAAAGACACCTCAAACAGG + Intronic
1087580100 11:100040421-100040443 GGAAGAATGCCTCCTCAAGTGGG - Intronic
1088004608 11:104925796-104925818 GACACACAGACTCCTCAAGTGGG - Intergenic
1090679257 11:129036056-129036078 GGAGAAATGACACTTCAAGTAGG - Intronic
1097645784 12:62234185-62234207 GGAAGAAAGACTTCTCAAGGAGG - Intronic
1097752882 12:63377787-63377809 GAAATACAGGCACCTCAAGTTGG + Intergenic
1098821062 12:75230296-75230318 GGAACAAAGAAACCGCAAAATGG - Intergenic
1099604846 12:84790659-84790681 GGAAAAAAGACATCTCTAGCAGG + Intergenic
1101223701 12:102666750-102666772 GGAAAAAAATCACTTCAAGTGGG - Intergenic
1101240678 12:102835126-102835148 GGAATAAAGAGACCTCAAAGAGG + Intergenic
1103319199 12:120080797-120080819 GGAACAAAGAGACCCCAGGCAGG - Intronic
1106499360 13:30312234-30312256 GGAAAAAAGAAACTTTAAGTAGG - Intergenic
1107877015 13:44799853-44799875 GGAATTAAGACCCCACAAGTGGG - Intergenic
1109413886 13:62010030-62010052 GGAACAATGACATCCCAATTAGG + Intergenic
1110680086 13:78300171-78300193 GGAAGAAAAACACCTCAATCTGG + Intergenic
1110917508 13:81041182-81041204 GGTACAAAGGCAACTCAAGTGGG + Intergenic
1113165429 13:107435382-107435404 TGAAGGAAAACACCTCAAGTGGG - Intronic
1118662681 14:68031498-68031520 GTAACAAAAACACATGAAGTTGG + Intronic
1125107514 15:35990412-35990434 GACCCACAGACACCTCAAGTTGG + Intergenic
1125677046 15:41507665-41507687 GAAAGAGAGACACCTCCAGTGGG + Intronic
1126002203 15:44221409-44221431 GAAAAAAAGACACCTCATTTTGG + Intergenic
1126181888 15:45793519-45793541 GGCACAAATACACCTCAGTTAGG + Intergenic
1126428765 15:48558113-48558135 GGAACAAGGAGACCTCAAATAGG - Intronic
1126931956 15:53663734-53663756 GCAACAAAGACACATCAAGATGG + Intronic
1128289940 15:66470662-66470684 GGCACAAAGATAGCTCAAGCTGG + Intronic
1134384867 16:13762278-13762300 GGAACTAAGGTACCTCAAATTGG - Intergenic
1134402724 16:13924895-13924917 GGAACAAAAAAAACTAAAGTAGG + Intronic
1135274901 16:21103714-21103736 GGAACTATGGCAGCTCAAGTTGG + Intronic
1140415588 16:74771849-74771871 GGAACAGAGACAGCCTAAGTGGG - Intronic
1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG + Intronic
1146945332 17:36869635-36869657 GGAACAAAGACTCGCCAAGTAGG + Intergenic
1150936271 17:69639052-69639074 GGAACAAAGCCATCTCTAGAGGG + Intergenic
1152919930 17:83061355-83061377 TGAGCACAGACAACTCAAGTCGG - Intergenic
1155652781 18:28160956-28160978 AGAAAAAAGGCACCTCAAGAAGG - Intronic
1156911152 18:42412518-42412540 GAAACCAATACACCTAAAGTTGG - Intergenic
1157152892 18:45237155-45237177 GAAACAAAGGCAGCTCAACTGGG + Intronic
1158448547 18:57542714-57542736 GGAAACAAGAGACCTCAAGGAGG - Intergenic
1158545287 18:58391065-58391087 GGTATAAAGTCACCTCCAGTAGG + Intronic
1158943753 18:62430604-62430626 AGAACAAAGAAAACTCAAGCTGG + Intergenic
1159436995 18:68431196-68431218 TGAACAAAGACAACAGAAGTGGG + Intergenic
1162392432 19:10397706-10397728 GGAACAAAGAAACATCTAGAAGG - Intronic
1164025004 19:21343844-21343866 GGAAAAAAATCACTTCAAGTGGG - Intergenic
1164318541 19:24117153-24117175 GGCAGACAGACTCCTCAAGTGGG - Intronic
1166385603 19:42378876-42378898 GGAACAAAGCCACCCCAGCTTGG - Intergenic
930324955 2:49903975-49903997 GAAACAAAGAAACCAGAAGTGGG - Intergenic
931583513 2:63803059-63803081 GTAACACAGACACCTCATATAGG + Intronic
933258767 2:80108742-80108764 GGCAGAAAGACACCTCAAAATGG + Intronic
933372318 2:81430710-81430732 GGTAAAAAGAATCCTCAAGTGGG - Intergenic
936033091 2:109087673-109087695 GGAACAATGATACCTAGAGTGGG + Intergenic
941585344 2:167351338-167351360 TGTACAAAAACACCTCCAGTAGG - Intergenic
942490187 2:176482164-176482186 GGAGCAAAGGAACCTGAAGTTGG - Intergenic
946074487 2:217062704-217062726 GGAAGAAAGAAACCTGAATTGGG - Intergenic
1171982874 20:31639432-31639454 AGAAGAAAGAGACCTAAAGTAGG + Intronic
1175777794 20:61663952-61663974 GGCACACAGACACCTCAACGTGG - Intronic
1177743511 21:25182538-25182560 GAAACAAAGACATCTCAGTTTGG + Intergenic
1179350088 21:40600807-40600829 GGAACAAAGACAATTCAATGGGG - Intronic
1179489913 21:41734481-41734503 GGAAGGAAGACACCTCAGGGAGG + Intergenic
1183425517 22:37737116-37737138 GGCACACAGACAGCTCAAGGAGG + Intronic
1184619558 22:45665358-45665380 GGAACCAAAACACCTGAATTGGG - Intergenic
951658237 3:25033264-25033286 GGAGCAAAGACAATTAAAGTAGG + Intergenic
952103989 3:30048937-30048959 GGAACAAATATACCTATAGTTGG - Intergenic
953194507 3:40719920-40719942 GGGAAAAAAACACCTCAAATGGG + Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
955291890 3:57699794-57699816 GGAACAAAGAAATCTCTAATTGG - Intergenic
958555023 3:95662645-95662667 GGAAGACTGACTCCTCAAGTGGG - Intergenic
961608206 3:128113942-128113964 TGAAGAAGGATACCTCAAGTAGG + Intronic
963076306 3:141349818-141349840 GGAAGAAAGAAACCCCCAGTTGG + Intronic
963381379 3:144534669-144534691 GGAAGAAAGAAACCTAAAATGGG + Intergenic
964231729 3:154478120-154478142 AGAACAAAGACAACTAAAGTGGG + Intergenic
965696328 3:171412065-171412087 AGAGCAAGGACAACTCAAGTAGG - Intronic
976780643 4:88754919-88754941 GGATCAAAGTCAGCTCAAATGGG - Intronic
977220233 4:94329510-94329532 GGAACATAACCACCTCAAATAGG + Intronic
979674350 4:123396002-123396024 GGAAAAAAAACACTTTAAGTAGG - Intergenic
980568650 4:134580615-134580637 AGAACAAACACAACTAAAGTTGG + Intergenic
981508697 4:145531295-145531317 TAAACAGAGACACTTCAAGTAGG - Intronic
982692914 4:158567899-158567921 AGAACAAAGCCACCACAAGCTGG - Intronic
985189593 4:187357821-187357843 GGAAGAAACACAACTCAAATGGG - Intergenic
988492019 5:31712936-31712958 GGAACAAAGAAGGCTCATGTTGG - Intronic
988544908 5:32146402-32146424 AGGACAGAGACACCCCAAGTAGG + Intronic
990307043 5:54503991-54504013 GGAAAAAAATCACCTCAGGTGGG - Intergenic
990453807 5:55963358-55963380 GGACCAAAGATGCCTCAACTTGG - Exonic
991138732 5:63214376-63214398 GGAACAAAGCTACTTCAAGACGG - Intergenic
993929114 5:93915807-93915829 GGAAGAAAGATACTTCATGTTGG + Intronic
994342186 5:98643516-98643538 GGAATAAAGAGACCACACGTGGG + Intergenic
996292737 5:121872788-121872810 CAAATAAAGACACCTCAAGCAGG + Intergenic
999890061 5:155967834-155967856 GCCACAGAGACACCTCAAGAAGG + Intronic
1000241263 5:159410532-159410554 GGTACAAGGACAACTCAATTGGG - Intergenic
1004411973 6:15389547-15389569 GGAACAAAGTCATCTCATGGAGG - Intronic
1004910888 6:20282243-20282265 GGATCAAAGAAACCAAAAGTTGG + Intergenic
1007326782 6:41068018-41068040 GGAAAAAAGAGACCTAAAATTGG + Intronic
1010987589 6:82442804-82442826 GGAAGAAAGACTCCCCAAGATGG + Intergenic
1011612228 6:89163747-89163769 AAAACAAAGATACCTCAAGCAGG - Exonic
1012639760 6:101595045-101595067 GGTACCGAGAAACCTCAAGTAGG + Intronic
1013536392 6:111066736-111066758 GGAAAACAGACACCTAAACTGGG - Intergenic
1019888337 7:3924799-3924821 GGAAAACAAACACTTCAAGTGGG - Intronic
1021392704 7:20113705-20113727 GGAAAAAAAAAACCTCAATTTGG + Intergenic
1021996940 7:26188106-26188128 AGAACAAAGACAACCCAAGTGGG + Intergenic
1022727052 7:32990874-32990896 GGATCCAAGAAACGTCAAGTTGG + Intronic
1023033650 7:36112004-36112026 GGAAGAAAGACTTCTCAAGGAGG + Intergenic
1023736652 7:43241570-43241592 GGAAAAAAGACCACTCAAATGGG - Intronic
1024358637 7:48444654-48444676 GGAACAAGGAAACCTCAGTTAGG - Intronic
1025046528 7:55696756-55696778 GGATCCAAGAAACGTCAAGTTGG - Intergenic
1027656752 7:80940191-80940213 GGAACAAAATCACCCCCAGTTGG + Intergenic
1032072202 7:128815112-128815134 GGAACACAGACAACTCACATCGG + Intronic
1033928785 7:146497499-146497521 GGAACTAAGAAGCCTGAAGTTGG - Intronic
1034622749 7:152468909-152468931 GAAACAAATACACCTTGAGTTGG + Intergenic
1038161125 8:25039314-25039336 GAAGCAAAGATACCTCAATTGGG - Intergenic
1041333145 8:56750377-56750399 GGTACAAAGACACCTGAAAGAGG - Intergenic
1041425807 8:57719061-57719083 TGAACAAAGCCACATCAAGCTGG + Intergenic
1043609419 8:82043867-82043889 GAAACATAGCAACCTCAAGTAGG - Intergenic
1049510116 8:143023033-143023055 TGAACAAACACACCTCCACTGGG - Intronic
1052206468 9:25847294-25847316 AGAACGAAGCCACCTCAAGTAGG + Intergenic
1185917944 X:4056868-4056890 GGAACGAAGATGCCTCAAGAAGG - Intergenic
1185928956 X:4180645-4180667 GGAACAAAGAGATCTGAAGAAGG + Intergenic
1186360147 X:8832586-8832608 GGAACAAAAAGACCTTAATTTGG + Intergenic
1187007646 X:15248117-15248139 GGAACAAAGACACCTCAAGTTGG - Intronic
1191254894 X:58275430-58275452 GAACCCAAGACACCTCCAGTAGG + Intergenic
1191565055 X:62517774-62517796 GGCACACAGCCTCCTCAAGTGGG + Intergenic
1199210038 X:145197257-145197279 GTAAAAAAGACACCTGGAGTTGG - Intergenic