ID: 1187016660

View in Genome Browser
Species Human (GRCh38)
Location X:15335526-15335548
Sequence GGCTGCAGCCGCGGGAGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187016660_1187016671 15 Left 1187016660 X:15335526-15335548 CCGGACCTCCCGCGGCTGCAGCC 0: 1
1: 0
2: 1
3: 29
4: 331
Right 1187016671 X:15335564-15335586 TGTTCCGCAGCACCAATCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 50
1187016660_1187016670 14 Left 1187016660 X:15335526-15335548 CCGGACCTCCCGCGGCTGCAGCC 0: 1
1: 0
2: 1
3: 29
4: 331
Right 1187016670 X:15335563-15335585 CTGTTCCGCAGCACCAATCTAGG 0: 1
1: 0
2: 0
3: 2
4: 61
1187016660_1187016674 30 Left 1187016660 X:15335526-15335548 CCGGACCTCCCGCGGCTGCAGCC 0: 1
1: 0
2: 1
3: 29
4: 331
Right 1187016674 X:15335579-15335601 ATCTAGGGCGTCCGCGCCCAAGG 0: 1
1: 0
2: 0
3: 0
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187016660 Original CRISPR GGCTGCAGCCGCGGGAGGTC CGG (reversed) Intronic
900095698 1:939281-939303 TGCTGCTGCCGCGGGAGCTGGGG + Exonic
900127364 1:1074468-1074490 CGCTGCAGCCTGGGCAGGTCTGG + Intergenic
900205006 1:1427922-1427944 GGCTGCGGGCGGGGGAGGCCGGG - Intergenic
901086689 1:6615069-6615091 GGCGGCTGCCGCGGGAGGGCGGG + Intronic
901828606 1:11878773-11878795 CGCTGCAGCCGCAGGAAGCCCGG - Intergenic
903186707 1:21633331-21633353 GCCTGCAGCCTGGGGAGGTTAGG - Intronic
903373153 1:22849931-22849953 AGCTGCATCCCCGGGGGGTCCGG + Intronic
903648192 1:24907218-24907240 GGCTGCAGCGGGGTGAGGTGGGG - Intronic
904588563 1:31594186-31594208 GGCTGCAGCAGGGGGAGGTGTGG - Intergenic
905380673 1:37559425-37559447 AGCTGCAGCAGCGGCAGGCCAGG + Exonic
905410433 1:37764739-37764761 GGCTGGAGACCCGGGAGGTTGGG - Intronic
905749503 1:40450128-40450150 GGCTGCAGCGGTGGGAAGGCGGG + Exonic
905870987 1:41404561-41404583 GGCTGCAGCCGCTGGGGGCTGGG + Intergenic
906003729 1:42449912-42449934 AGCTGCAGCAGCGGCAGGTAGGG - Exonic
906140490 1:43531230-43531252 GGCTGCGGGCGCGGCAGGTGGGG - Intronic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
907399876 1:54218445-54218467 GGCTTCAGCTGGGGCAGGTCAGG - Intronic
910051369 1:82978024-82978046 GGCTGCACTCCCAGGAGGTCAGG - Intergenic
912795817 1:112692913-112692935 GGCTGCTCACGCTGGAGGTCAGG + Exonic
914889759 1:151612259-151612281 GGCGGCGGCGGCGGGGGGTCTGG + Exonic
915023577 1:152805187-152805209 GGCTGCAGCAGCCAGAGCTCTGG + Exonic
915024289 1:152812716-152812738 GGCTGCAGCAGCCAGAGCTCTGG - Exonic
915025723 1:152827718-152827740 GGCTGCAGCAGCCAGAGCTCTGG - Exonic
915574758 1:156768065-156768087 GGCTGAAGCGGCGGGAGTTGGGG + Exonic
917855081 1:179093091-179093113 GGCTGCAGCCCAGGGAGGGGAGG + Intronic
919748619 1:201023452-201023474 GGCTGCGGCTGCGGGAGGCGGGG + Exonic
921189740 1:212699285-212699307 GGCTACAGGCGCGGGTGGTGGGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921243396 1:213210139-213210161 GGCTGCATTCTCAGGAGGTCAGG - Intronic
921587505 1:216965492-216965514 GGGTCCAGCCACAGGAGGTCAGG - Intronic
922165529 1:223112798-223112820 AGCTGCAGCTGCTGGAGCTCGGG - Exonic
923467411 1:234261665-234261687 GGCTGCATCCCCAGGAGGTTAGG - Intronic
924331703 1:242946394-242946416 TGCTGCAGCAGTGGCAGGTCAGG - Intergenic
924825927 1:247538925-247538947 GACTGCAGCTGGAGGAGGTCAGG - Intronic
924878913 1:248136856-248136878 GGCTGGAGCCGCCTGAGGCCTGG - Intergenic
1063420539 10:5909282-5909304 CGCTGCTGCCGGGGTAGGTCTGG + Exonic
1066265941 10:33775714-33775736 GGCTGCAGTCCCAGGAGGTTAGG - Intergenic
1066644802 10:37595605-37595627 GGCTGCAGCCAGAGGAGGCCAGG - Intergenic
1069019160 10:63466041-63466063 GGCAGCAGCCGCGGGAGGGTCGG + Intergenic
1069721716 10:70554015-70554037 GGCTGCAGCCCCGTGAAGTCGGG - Intronic
1071070117 10:81681804-81681826 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1071526410 10:86362285-86362307 GGCTCCAGCCAGGGGAGGGCAGG - Intronic
1072629630 10:97136238-97136260 GGCTGTACCCGTGGGAGGGCAGG + Intronic
1073057200 10:100710326-100710348 GGGAGGAGCCGCGGGAGGGCAGG - Intergenic
1073432274 10:103494247-103494269 GGCTGCAGCCGGGGGCGGGCGGG - Exonic
1073460342 10:103662138-103662160 GGGTGCAGCAGAGGGAGGGCAGG + Intronic
1074494133 10:113964268-113964290 GGCTGCAGCTTCGGGAGGAATGG + Intergenic
1074603540 10:114938367-114938389 GGCTGCAGCCGCGGTGGTTGCGG + Exonic
1074682006 10:115916763-115916785 AGCTGCAGCCTTGGGAGCTCAGG + Intronic
1074721830 10:116271446-116271468 GGCTGGAGCCGGGGGTGGCCCGG - Intronic
1075259410 10:120949678-120949700 GTCTGCAGCCGCGTGAGCTCGGG + Intergenic
1075520024 10:123137617-123137639 GGCTGCAGCCGCGGGGGCCCCGG + Exonic
1076116949 10:127907395-127907417 GGCCGCTGCCGCGGGAGGGAGGG + Intronic
1076701412 10:132275168-132275190 GACAGCAGCCATGGGAGGTCCGG + Intronic
1076768915 10:132652353-132652375 GGCTGCAGCCCCAGGAGGAGCGG + Intronic
1077058606 11:607986-608008 GGCAGCAGCCCCGAGAGGTCTGG + Exonic
1077084530 11:742338-742360 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1077186649 11:1238446-1238468 GACTGCAGCGGAGGGAGGTGGGG + Intronic
1077217635 11:1401634-1401656 GGCAGCAGCCGTGGGTGGTATGG + Intronic
1077219317 11:1408398-1408420 GGCAGCAGCCACGGGAGAACTGG + Intronic
1077252894 11:1568373-1568395 GGCTGGAGGGGCGGGAGGACGGG + Intronic
1077352098 11:2097770-2097792 GGATGCAGCCGCTGAAGGGCCGG + Intergenic
1077551811 11:3203765-3203787 GGCTGCAGCCGCTGCAGTCCAGG + Intergenic
1079102138 11:17548191-17548213 GGCTACAGTCGTGGGAGGCCAGG + Exonic
1082929004 11:58579546-58579568 GGCTGCTGCCCGGGGACGTCGGG - Exonic
1083657695 11:64237572-64237594 GGCAGCGGCAGCGGCAGGTCCGG - Exonic
1084302858 11:68262584-68262606 GGCTGCAGTCGTGGGAGCACTGG + Exonic
1084367671 11:68713301-68713323 GGGTGCAACTGCAGGAGGTCAGG - Exonic
1085624856 11:78064099-78064121 GGCTGCTGCCGCGGGAGGAGTGG + Exonic
1085929123 11:81059472-81059494 GGCTGGAGCAGAGGGAGGTAGGG - Intergenic
1090136495 11:124204475-124204497 GGCTGCAGCTGCTGGGGGTGGGG + Intergenic
1090635802 11:128689862-128689884 GGCCGCGGCGGCGGGAGGGCCGG - Intronic
1091120229 11:133051399-133051421 GGCTGCAGCCCTGGAATGTCTGG - Intronic
1091297806 11:134486216-134486238 GGCTGCACCCTCTGAAGGTCAGG - Intergenic
1091393715 12:141148-141170 GGATGAAGCCGCGTGAGATCAGG - Exonic
1092861891 12:12725626-12725648 GGCTGGGGCCGCGGGAGATTCGG - Intergenic
1093894810 12:24563276-24563298 GGCTGGAGCCGCGAGAGGTTCGG + Intergenic
1095953076 12:47791883-47791905 GGCTGCAGGAGCGGGGGCTCCGG - Exonic
1096121657 12:49092679-49092701 GGCTGCTGCCCCCGCAGGTCAGG - Intronic
1096191274 12:49621836-49621858 GGCTGCAGCTGGGGGAAGGCCGG + Intronic
1096613302 12:52817113-52817135 GGCTGCAGCTGCAGGAGCTGAGG + Intergenic
1097964239 12:65562072-65562094 GGCTGCATTCCCAGGAGGTCAGG + Intergenic
1098921258 12:76304272-76304294 GGCTGCATTCTCAGGAGGTCAGG - Intergenic
1099244094 12:80173645-80173667 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1104735810 12:131135548-131135570 GGCTGCAGCCCAGTGAGGCCTGG + Intronic
1105532359 13:21231264-21231286 GGGTGCAGCCGCAGGAGCCCAGG - Intergenic
1107127913 13:36864389-36864411 GGCTGCATTCCCAGGAGGTCAGG + Intronic
1108459357 13:50649696-50649718 GGCTGCATTCCCAGGAGGTCAGG - Intronic
1109335620 13:60990525-60990547 GGCTGCAGCTGCGGTAGGAGAGG - Intergenic
1110597018 13:77329907-77329929 GGCTGCAGCCGGGGGGCGTGGGG + Intergenic
1112508416 13:99989115-99989137 TGCTCCAGCCGCGGCAGGTTGGG - Intergenic
1112643727 13:101306167-101306189 GTCTGCAGCCTCGGGAGCTCTGG - Intronic
1113582527 13:111439167-111439189 AGCTGCAGACTCAGGAGGTCTGG + Intergenic
1114940610 14:27605584-27605606 AGCTGCAGCTGCGGGAAGACTGG + Intergenic
1116345731 14:43790885-43790907 GGCTGCATTCCCGGGAGGTTAGG - Intergenic
1118427795 14:65685984-65686006 GGCTGCATTCCCAGGAGGTCAGG - Intronic
1121246644 14:92465556-92465578 GGCACCAGCCGAGGGAGCTCTGG + Intronic
1121286045 14:92736742-92736764 GGCTGCAGTCCCAGGAGGTTAGG - Intronic
1121336026 14:93077947-93077969 GGCTGCAGCCAGGCAAGGTCAGG + Intronic
1122149219 14:99715826-99715848 GGAAGCAGCTCCGGGAGGTCCGG + Exonic
1122601244 14:102922977-102922999 GGCAGGAGCCGCCGGAGGCCGGG - Intronic
1122602750 14:102929637-102929659 GGCTCCTGCGGCGGGAGGGCAGG - Exonic
1122742412 14:103879958-103879980 GGTTGCACCCGTGTGAGGTCAGG - Intergenic
1122745959 14:103897380-103897402 GGCTGCAGAGGGGGGAGGTGGGG - Intergenic
1122799684 14:104223368-104223390 GCCTGCAGAGGCGGGAGGGCAGG - Intergenic
1122802410 14:104238269-104238291 GGCTGCAGCCTCAGGAGGAGAGG + Intergenic
1122977552 14:105177129-105177151 GCCAGCAGCCCAGGGAGGTCAGG + Intronic
1124158270 15:27247424-27247446 GGCTGCAGCCACACCAGGTCAGG - Intronic
1124438927 15:29673330-29673352 GGCTGCATCCCCAGGAGGTTAGG - Intergenic
1126158086 15:45584171-45584193 GGCTGCATCCCCAGGAGGTTAGG - Intergenic
1126436713 15:48645113-48645135 GGCTGCTGCCGCCGGGGGCCTGG - Intronic
1126802469 15:52311259-52311281 GGATGAAGCTGGGGGAGGTCTGG + Exonic
1127439112 15:58988158-58988180 GGCTGCGGCCGCGGAAGGCTGGG + Intronic
1128104034 15:65029666-65029688 GGGTGCAGCCTGGGGAGGGCGGG + Intergenic
1128429071 15:67573626-67573648 GGCCGCAGCCCCAGGAAGTCAGG + Intronic
1128766580 15:70254802-70254824 GGCTGCGGCCGGGGGAGGCGGGG - Intergenic
1128992491 15:72272510-72272532 GGCTGCGGCCGCGCGCGGCCCGG - Exonic
1129194494 15:73955926-73955948 GGCTGCAGCCTGGTGAGGGCTGG + Intergenic
1130115596 15:81002089-81002111 GGCTGCGGCGGCGGGAGCCCGGG - Exonic
1130545932 15:84857690-84857712 GGGGGCAGCCACCGGAGGTCTGG + Exonic
1131683758 15:94750385-94750407 GGCTGCAGCTGAGTGAGGCCAGG + Intergenic
1132295107 15:100728930-100728952 GGCTGCAGCTGAGGAAGGGCAGG - Intergenic
1132555373 16:569831-569853 GGAGGCAGGCTCGGGAGGTCCGG + Intronic
1132596058 16:750696-750718 GGCTGCACTCTCCGGAGGTCTGG + Intronic
1132662189 16:1066447-1066469 GTCTGCAGCTGCGTGGGGTCCGG + Intergenic
1132877931 16:2148564-2148586 GGCGGCGGCGGCGGGAGGCCGGG + Intronic
1133284875 16:4686018-4686040 GGCTGCGGCAGCGGGAGGTATGG + Intronic
1133774492 16:8886365-8886387 GGGAGCAGCCTGGGGAGGTCGGG - Intergenic
1134095914 16:11418296-11418318 GGCTGCATTCCCAGGAGGTCAGG + Intronic
1134592353 16:15464894-15464916 GGCTGCAACCCCAGGAAGTCAGG - Intronic
1137988574 16:53130800-53130822 GGCTGGAGCCGCGGCAGGAGCGG + Intronic
1138599407 16:58046050-58046072 GGCTGCTGCCGGGGGTGGGCTGG - Exonic
1139205418 16:65023957-65023979 GGCTGCATCCCCAGGAGTTCAGG - Intronic
1139357157 16:66373259-66373281 GGCTGCAGCCTCTGGAGATGTGG - Intronic
1139496918 16:67326714-67326736 GGCTCCAGCAGCGGGCGGGCGGG + Exonic
1141160778 16:81627971-81627993 GGCTGCACCCTCAGGAGGGCGGG + Intronic
1141841630 16:86577606-86577628 GGCAGCTGGCGCGGGAGGCCTGG - Intronic
1142171283 16:88624097-88624119 GGCTGCAGCCTGTGGAGGCCTGG - Intronic
1142346453 16:89557106-89557128 GGCTGCACGTGCGGGTGGTCCGG + Exonic
1142592818 17:1013822-1013844 GGCTGGAGCCCAGGGAGGTGCGG + Intronic
1142810532 17:2393702-2393724 TGGTGCAGCCGCGGGAGGGAAGG - Intronic
1142968783 17:3597327-3597349 GGCTCCTGCCCCCGGAGGTCTGG + Intergenic
1143151029 17:4807637-4807659 GGCGTCATCCGCGGGCGGTCAGG + Intronic
1143164186 17:4889793-4889815 GGCAGCAGGAGCGGGAGGGCGGG - Intronic
1143586731 17:7854233-7854255 GGCTGGAGCCGCGGGCGGACGGG - Exonic
1143632561 17:8147380-8147402 GGCTGCAGCAGGGAGAGGGCAGG + Exonic
1144774588 17:17778886-17778908 GTCTGCAGCAGCTGGAGGTGAGG + Intronic
1144952121 17:19000046-19000068 GGCTGCAGCCAAGTGAGGCCGGG + Intronic
1146660742 17:34663711-34663733 GGCTGCAGCAGGGGGAGGTGGGG - Intergenic
1147015631 17:37489677-37489699 GGCTGCTGCCTCGGGAGCTAGGG + Intergenic
1147427127 17:40351254-40351276 GGCTGCTGACGCGGGAGGAAGGG - Intronic
1147760782 17:42796273-42796295 GGCTGTTGCGGCGGGAGGTGGGG - Exonic
1149610482 17:57955194-57955216 GGCGGGAGCCGCGGGAGCGCGGG + Intronic
1150561918 17:66302319-66302341 GGCGGCGGCCGGGGGAGGGCCGG - Intergenic
1150840384 17:68601018-68601040 GGCTGCCACCGCGGGCGGACGGG + Exonic
1151252994 17:72852151-72852173 GAGTGCAGCCGCGGGATCTCGGG - Intronic
1151707539 17:75778776-75778798 GCCTGGAGCCGGGGGAGGGCTGG - Intronic
1151765287 17:76130619-76130641 GGCAGGGGCCCCGGGAGGTCAGG - Intergenic
1151865830 17:76801890-76801912 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1152019011 17:77770806-77770828 GGCTGCAGCCGGGGGTGGGCTGG - Intergenic
1152742226 17:82023358-82023380 GGCTGCAGGCGGGGCAGGGCTGG + Exonic
1152914058 17:83023766-83023788 CCCTGCAGCTGCTGGAGGTCGGG - Intronic
1154172562 18:12061906-12061928 GGCTGCAGCCGTGGCAGGGTTGG + Intergenic
1157496798 18:48162084-48162106 GCCTGCGGCGGCGGGGGGTCTGG - Intronic
1157794103 18:50559625-50559647 GGCTGCAGCCGCCGGGGGCCCGG - Intergenic
1158249107 18:55466971-55466993 AGGTGCAGCAGCGTGAGGTCAGG - Intronic
1160465156 18:79069736-79069758 GGCTGCATCCCCGGGACGCCTGG + Intronic
1160500978 18:79400900-79400922 GGCGGCAGGGGCGGGAGGTCAGG - Intronic
1160732090 19:645936-645958 GGCTGCAGGCGCGAGGGGCCCGG + Intergenic
1160860055 19:1233912-1233934 GGCTGCAGGTGAGGGAGGGCAGG + Intronic
1160957612 19:1700612-1700634 GGCTGCTGCCGAGGGAGATGAGG + Intergenic
1160988081 19:1848676-1848698 CGCTACAGCCGCCGAAGGTCGGG - Intergenic
1161208135 19:3052860-3052882 GGCTGCCCCCGGGGGAGGACGGG - Intergenic
1161262332 19:3344948-3344970 GGCTGCAGCGGAGGGAGGAGAGG + Intergenic
1161317362 19:3623880-3623902 GGCTGCGGCTGCGGGAGGAGCGG - Exonic
1161333775 19:3700267-3700289 GGCCGCAGCCCCGGGAGGCCGGG + Intronic
1161550819 19:4911076-4911098 GGCTGCAGAGGCGCGAGGCCTGG - Intronic
1162967117 19:14161278-14161300 GGCTGCAGCCAGGGGAGGGATGG - Intronic
1163357153 19:16821302-16821324 GGCTGCATTCCCGGGAGGTTAGG + Intergenic
1163862996 19:19752072-19752094 GGCTGAGGCCGCGGGAGGGCTGG - Intergenic
1164207677 19:23071422-23071444 GGCAGCTGCCGCTGGAGCTCCGG + Intergenic
1165305454 19:35000352-35000374 GGCGGCGGCCGCGGAAGGCCAGG + Exonic
1165452194 19:35890165-35890187 GGCTGTGGCCGGGGGAGGTCTGG - Intronic
1165758506 19:38307723-38307745 GCTTGCAGCCCCAGGAGGTCTGG + Exonic
1166297455 19:41896069-41896091 GACTGCAGCCCCCTGAGGTCGGG - Intronic
1166297569 19:41896495-41896517 GGGTGCAGGGGCGGGAGGTGTGG + Intronic
1166913466 19:46177723-46177745 GGCTGCAGCTGGGGGAGATGAGG + Intergenic
1167410138 19:49339531-49339553 GGGTGGAGCGGCGGGAGGGCCGG - Intronic
1167455916 19:49596697-49596719 GGCAGCACCAGTGGGAGGTCAGG - Exonic
1167619275 19:50552024-50552046 GGAGGCAGCCGAGGAAGGTCGGG + Intronic
1168064012 19:53909331-53909353 GGCCGCGGCCGCGGGGGGTGGGG + Exonic
925163281 2:1701682-1701704 GTCTGCAGCCGTGGGGGCTCAGG - Intronic
926112477 2:10192111-10192133 GGCTGCGGCTCCGGGAGCTCTGG - Intronic
926189955 2:10721284-10721306 GGCGGCCGCAGCGGGAGGGCGGG + Intergenic
927293224 2:21424579-21424601 GGCTGCAGCCCTGTGATGTCAGG - Intergenic
927497221 2:23559104-23559126 GGCTGTAGCCGGGGGAGGGTCGG + Intronic
927658532 2:24972046-24972068 GGCAGCAGGCGCGGGCGGTTGGG + Exonic
928172491 2:29012433-29012455 GGCTGCAGCAGGGTGAGCTCAGG + Intronic
928433774 2:31240606-31240628 GGCTGCAGCCCGAGGTGGTCAGG - Intronic
928511625 2:32009608-32009630 GGCTGCGGGCGCGGGGGCTCGGG + Intronic
928998769 2:37324922-37324944 GGTGGCCGCGGCGGGAGGTCGGG + Intergenic
930173929 2:48281896-48281918 AGCGGCAGCCTCGGGAAGTCAGG - Intergenic
934098199 2:88627019-88627041 GCCGGCAGCCGCGGGAGAGCAGG - Exonic
934475060 2:94588232-94588254 GGCTGCAGACAGGGAAGGTCAGG + Intergenic
934934006 2:98451531-98451553 CGCTGCAGCAACCGGAGGTCAGG - Intronic
936981862 2:118272172-118272194 GGCTGCAGCCCCAGGAGCTCAGG - Intergenic
939038848 2:137164150-137164172 GGCTGCAGTTGTGGGAGGGCAGG + Intronic
945470711 2:210225153-210225175 GCCTGCAGCCGCGGAAGTCCCGG + Intronic
946415568 2:219538243-219538265 GGCTGGTGCCCCGGGAGGGCTGG + Exonic
1168949793 20:1789261-1789283 GGCTGCAGCAGCTGGGGGTGGGG + Intergenic
1169130904 20:3166014-3166036 GGCAGCAGCGGTGGGGGGTCGGG - Exonic
1169190113 20:3653380-3653402 GGCTGCATCACCTGGAGGTCTGG + Intergenic
1169192832 20:3668848-3668870 GCCTGCAGGTGCTGGAGGTCCGG + Exonic
1170163401 20:13338460-13338482 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1171512313 20:25696055-25696077 GGCAGCGTCCGCGGGAGGTGAGG - Intronic
1172798452 20:37559540-37559562 GGCTGCATTCCCGGGAGGTTAGG + Intergenic
1173895289 20:46546178-46546200 GGCTGCTGCTGCTGCAGGTCTGG - Exonic
1173939097 20:46894840-46894862 GGCAGCAGCCGCGGCAGCCCAGG + Exonic
1174880055 20:54269131-54269153 TGCTGCAGCCTCAGGAGGTTTGG + Intergenic
1175191040 20:57212362-57212384 GCCTCTGGCCGCGGGAGGTCAGG + Intronic
1176070673 20:63224675-63224697 GGCCACAGCCACGGGAGGTGTGG + Intergenic
1176200256 20:63856948-63856970 GTCTGCAGCGGGGAGAGGTCTGG + Intergenic
1176244762 20:64092122-64092144 GGCCTGAGCCGCTGGAGGTCGGG + Intronic
1178350059 21:31866418-31866440 GCCTGCAGCAGCGAGGGGTCTGG - Intergenic
1178431482 21:32522121-32522143 GGCTGCAGCCCCAGGGGGACAGG - Intergenic
1178469829 21:32882643-32882665 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1178922591 21:36748123-36748145 CGCCGCAGCCCCGGGAGGCCGGG - Exonic
1179238321 21:39566630-39566652 GGCTGCAGCCGGGGGAGAGGGGG - Intronic
1179519481 21:41932688-41932710 GGCCGCAGCCGCGGCTGGGCCGG + Intronic
1179723262 21:43327496-43327518 GGCTTGAGCCTGGGGAGGTCAGG + Intergenic
1179967469 21:44815716-44815738 GGCTGCAGCCCCGGGGGGAATGG + Intronic
1180067298 21:45418810-45418832 GGCCGCAGGCACAGGAGGTCGGG - Intronic
1180796984 22:18610723-18610745 GGCAAGAGCCGCTGGAGGTCTGG + Exonic
1181224740 22:21384548-21384570 GGCAAGAGCCGCTGGAGGTCTGG - Exonic
1181253892 22:21550265-21550287 GGCAAGAGCCGCTGGAGGTCTGG + Exonic
1181496253 22:23288906-23288928 GCCTGAGGGCGCGGGAGGTCAGG - Intronic
1181725130 22:24806225-24806247 TGCTGCAGCCGCGGCGGGGCGGG - Intronic
1182212660 22:28689780-28689802 TGCTGCAGGAGCGGGAGGTGAGG + Intronic
1182697341 22:32206063-32206085 GGCTGCAGCAGGGGCAGGTTGGG + Intergenic
1183050688 22:35258006-35258028 GGCCGCGGCCACGGGAGGGCTGG + Intronic
1183325511 22:37189386-37189408 GGCTGCATTCCCAGGAGGTCAGG - Intronic
1183366613 22:37410392-37410414 GGCTGCAGCCCAGAGAGGTGAGG - Intronic
1183641816 22:39097416-39097438 GGCTGGGGCAGCGGGAGGCCAGG - Intronic
1183669215 22:39262509-39262531 GGCTGCAGCAGAGAGAGGTGGGG - Intergenic
1184106316 22:42369264-42369286 GGCTGCAGCGGGGCGTGGTCTGG + Intergenic
1184660608 22:45963942-45963964 GGCTGCAGCTCCTGGAGGTGCGG - Intronic
1184722317 22:46322184-46322206 GGGTGCAGGCGCAGGAGGGCGGG + Intronic
1184924085 22:47625275-47625297 GTCTGCACCCTCGGGAGCTCTGG - Intergenic
1185021501 22:48379401-48379423 GGCTGCACCTGCAGGAGCTCTGG - Intergenic
1185038297 22:48490654-48490676 GGCTTCAGCTCCGGGAGCTCCGG + Intronic
1185045516 22:48526582-48526604 GGATGCACCCGCAGGAGCTCCGG - Intronic
1185199574 22:49493464-49493486 GGCTGCTGCCCTGGGAGGCCCGG + Intronic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
949559399 3:5188017-5188039 GGCTGCAGCCGCCGGGGACCGGG + Exonic
950229689 3:11265759-11265781 GGCTGCACTCCCAGGAGGTCAGG + Intergenic
950705504 3:14777451-14777473 GGCTGCAGCCTGAGGAGGACAGG + Intergenic
950713350 3:14829471-14829493 GGCTGCAGCCAGGGGAGGAGTGG + Intronic
951907967 3:27722194-27722216 GGCGGCAGCGGCGGGAGCGCTGG - Exonic
953680685 3:45035960-45035982 GGCAGGGGCCGCGGGAGGCCGGG + Exonic
953684977 3:45070537-45070559 GGCTGAGGCCGGGGGAGGCCTGG - Intergenic
953851004 3:46465372-46465394 GGCTGCTGCTGGGGGTGGTCGGG - Intronic
954415031 3:50389136-50389158 GGCTGCAGCCCCGGTGGGCCTGG + Intronic
956446189 3:69328507-69328529 GGCTGCATTCACAGGAGGTCAGG + Intronic
959863774 3:111243269-111243291 GGCTGCAGCTGTGGGTGGTGGGG + Intronic
960096752 3:113696666-113696688 AGCTGCGGCCGCGGGAGGGGCGG - Intergenic
961336061 3:126180398-126180420 GGCTGCAGCTCCGGGGGCTCCGG - Intronic
962119273 3:132544746-132544768 GGCTGCACCCCCGGGAGGTTAGG + Intergenic
962698685 3:137975823-137975845 GGCTGCAGCAGAGTGAGGTGGGG - Intergenic
966871139 3:184291244-184291266 GGCCTCAGCCGCTGGAGGGCTGG - Intronic
966904702 3:184513785-184513807 GGCTGCTGGCGAAGGAGGTCGGG - Intronic
967293321 3:187942822-187942844 GGCTCCAGCAGCGGCAGGGCGGG - Intergenic
967859686 3:194141551-194141573 GGCGGCGGCGGCGGGAGGCCGGG + Intergenic
968129612 3:196185114-196185136 GGCTGCAGGCGAAGGAGGTGAGG + Intergenic
968965341 4:3766547-3766569 GGGCGCAGCCGCGGCAGCTCGGG - Exonic
969033811 4:4234676-4234698 GGCTGCAGCCCTGGAAGGTAGGG - Intergenic
969725385 4:8915332-8915354 GGCTGCAGCAGCGCCAGCTCAGG + Intergenic
970115214 4:12687031-12687053 GGCTGAAGCAGGCGGAGGTCAGG + Intergenic
974032338 4:56787231-56787253 GGGGGCAGCCGGGGGAGGGCGGG + Intergenic
974055226 4:56977250-56977272 GGCAGCAGCGGCGGGAGGAGCGG - Exonic
976760089 4:88539348-88539370 GGCTGCAGCCTCGGGGGGAGAGG + Intronic
977592766 4:98844853-98844875 GGCTGCACACCCAGGAGGTCAGG - Intergenic
981772668 4:148328153-148328175 GGCAGCAGCCGTGGGAGGAATGG + Intronic
984952175 4:185016163-185016185 TGCTGCAGCCGCGCAAGGACCGG + Intergenic
985537338 5:472745-472767 GCCTGCAGCCGCTGCAGGTCGGG + Exonic
986206188 5:5627459-5627481 GGCTGCAGCCACGGAGGGGCAGG + Intergenic
990308955 5:54519356-54519378 GGCTGAGGCCGCGGAAGGACTGG - Exonic
990340921 5:54822189-54822211 GGCTGCATTCCCAGGAGGTCAGG + Intergenic
997295811 5:132767550-132767572 GGCTGCAGGTTGGGGAGGTCAGG + Intronic
997984586 5:138492300-138492322 GGCGGCAGCGGCGGGAGGGACGG + Intergenic
998188383 5:140000703-140000725 GGCTGCAGCAGGAGGAGGTGTGG - Intronic
998957642 5:147453737-147453759 GGCAGCCGCCGCGGGAGCCCGGG - Intronic
999238311 5:150113163-150113185 TGCTGCAGCCGTGAGGGGTCTGG + Intronic
999248197 5:150166722-150166744 GGCTGGGGCCGCGGGCGGCCCGG + Intergenic
1000060546 5:157651744-157651766 GGCTGCAGGAGCCGCAGGTCGGG + Exonic
1002307329 5:178291548-178291570 TGCTGCAGCAGCGGGAGGGCCGG + Intronic
1002716886 5:181233650-181233672 AGCTGCAGCCCCCAGAGGTCTGG + Exonic
1002896618 6:1383579-1383601 GGCTGCGGCGGCGGGAGGGAGGG - Intergenic
1004881603 6:20013811-20013833 AGCTCCAGCCACGGGAGGACTGG + Intergenic
1005244954 6:23872970-23872992 GGCTGCAGCAAAGGGAGATCAGG - Intergenic
1006154819 6:32008350-32008372 GGCTGCAGCCCCGGGGGATGGGG + Intergenic
1006161131 6:32041085-32041107 GGCTGCAGCCCCGGGGGATGGGG + Exonic
1006380296 6:33693340-33693362 GGCTGCAGCTGCGGCAGGGCAGG + Intronic
1006475271 6:34248973-34248995 GGCTGCAGCGGCGGGAGGTAAGG - Exonic
1009385222 6:63079089-63079111 GGGTGCTGCTGCAGGAGGTCTGG + Intergenic
1017146772 6:151241252-151241274 GGCCGCTGCCGCAGGAGGACTGG - Intronic
1017311513 6:152982580-152982602 GACTCCAGCCCCGGGAGGTGCGG - Intronic
1018023777 6:159788942-159788964 GACTGCAGCTGCGGGCGGACAGG + Intronic
1018652902 6:166006141-166006163 GGCAGCAGCCGCGGGCGGGCGGG - Intergenic
1018802611 6:167235822-167235844 GGCTGCAGCCGCCCGAGTTGGGG - Intergenic
1019317036 7:391583-391605 GGGTGCTGCCGCAGGAGGCCAGG + Intergenic
1020140227 7:5607737-5607759 GGCTGCTGCAGAGGGAAGTCGGG + Intergenic
1024084936 7:45885030-45885052 GGGGGCAGCCGCAGGAGGTGGGG + Intergenic
1024208502 7:47184029-47184051 GGCTGCAGTGGCGGGGGGTGGGG - Intergenic
1025087314 7:56033977-56033999 GGTTGCAGCCGCAGGAGCCCCGG - Exonic
1026562745 7:71463966-71463988 GGCTGCATTCCCAGGAGGTCAGG - Intronic
1026830153 7:73605717-73605739 GGCTGCAGTGGCGTCAGGTCCGG + Exonic
1026959687 7:74400430-74400452 TGCTGCAGCCGCAGAAGCTCGGG - Exonic
1028903795 7:96130888-96130910 GGCTGCAGCCAGGGTAGGTGGGG + Intronic
1032020728 7:128406005-128406027 GGCTGCGGCAGCGGCAGGGCGGG + Intronic
1033339207 7:140479048-140479070 GGCTAGAGGCGCGGGAGGGCGGG - Intronic
1034494150 7:151410108-151410130 GGCTGCAGGCGCGCGGGGTGGGG - Intronic
1035454960 7:159002083-159002105 GGCTGCAGTCACGGGAGCACAGG - Intergenic
1035746077 8:1962805-1962827 GGACGCAGGCCCGGGAGGTCAGG - Intergenic
1035761558 8:2072464-2072486 GGCTGCACCCGCTTCAGGTCCGG - Exonic
1038017752 8:23529421-23529443 GGCTGGAGCAGCGGGCGGTGCGG - Intronic
1038761086 8:30384666-30384688 GGCTGCAGCCGCTGGAAGGAGGG - Exonic
1039835959 8:41256523-41256545 GGCGGCAGCCTGGGGAAGTCTGG + Intergenic
1039861070 8:41458230-41458252 GGCTGCATTCCCAGGAGGTCAGG + Intergenic
1039903109 8:41767100-41767122 GGCTGCGGCCGCGGAGGGGCTGG - Intronic
1040582083 8:48706339-48706361 GGCAGCAGGGGCGGGAGGGCAGG - Intergenic
1041376901 8:57214936-57214958 GGCTGCAGCCAAGGAAGGGCAGG - Intergenic
1041918041 8:63155509-63155531 GGCTGCACTCCCAGGAGGTCAGG - Intergenic
1042902849 8:73746407-73746429 GGCTGCGGGCGCGGGAGGCTGGG - Intronic
1049607139 8:143534945-143534967 GGGGGCTGCCGCGGGAGGGCAGG - Intronic
1049796852 8:144500945-144500967 GGCTGCCGGCGCTGGAGGTGCGG - Exonic
1050351184 9:4741833-4741855 GGGTGCAGAAGCGGGGGGTCTGG - Intronic
1051655729 9:19379984-19380006 GGCTGGAGCCGCGGCGGGCCGGG - Intronic
1051919259 9:22245225-22245247 GGTTGCAGACGCCGAAGGTCTGG + Intergenic
1053014138 9:34652217-34652239 GGCAGCGGCCGCGGAAGGTGAGG + Intronic
1055486835 9:76764496-76764518 GGCTGCAGCCGAGGGAGACCAGG + Intronic
1056787546 9:89603948-89603970 GGCTGCAGCCCCTGGAGCTTAGG - Intergenic
1057613484 9:96567349-96567371 TGCTGCAGCCGCGCCAGGCCCGG + Intronic
1057716623 9:97501450-97501472 GGCTGCAGCCGAGCGAGCGCGGG - Intronic
1059104651 9:111501214-111501236 GGCTGCAGCGGAGGGAGGTGCGG + Intergenic
1059633961 9:116154402-116154424 GGCGGCAGCAGCGGGAGGCGAGG + Exonic
1060970324 9:127734186-127734208 GGCTGCAGCCGTGTGTGGCCTGG + Intronic
1061020507 9:128011299-128011321 GGCTGCAGCCACAGGAGCCCTGG - Intergenic
1061090633 9:128424090-128424112 GGCTGCAGCCCAGGCAGGGCTGG + Intronic
1061178860 9:129012514-129012536 GGCTGCAGGCACTGGAGCTCAGG + Intronic
1061280997 9:129597578-129597600 GGCTGCAGCCGCGGGATGAAAGG - Intergenic
1061725400 9:132579788-132579810 GGCTGGGGCGGCAGGAGGTCCGG + Intergenic
1062029878 9:134357408-134357430 TGCTGTAGCCGCGTGAAGTCAGG + Intronic
1062041562 9:134406753-134406775 GGCTGCGGCTCAGGGAGGTCAGG - Intronic
1062473619 9:136717345-136717367 GGCTGCAGGGGCCGGAGGTGGGG - Intronic
1187016660 X:15335526-15335548 GGCTGCAGCCGCGGGAGGTCCGG - Intronic
1190274331 X:48890742-48890764 GGCGGCAGCCGGAGGAGGCCCGG + Intergenic
1200083127 X:153589187-153589209 GGCTGCAGCCACCAGAGATCTGG - Intronic
1200252638 X:154561895-154561917 GGCTGCAGCTGCGACAGCTCAGG + Intronic
1200265129 X:154642521-154642543 GGCTGCAGCTGCGACAGCTCAGG - Intergenic
1201229042 Y:11845559-11845581 TGCTGCAGCGGTGGCAGGTCAGG - Intergenic
1201788312 Y:17809103-17809125 GGCTGAAGCCGCAGGAGTGCAGG - Intergenic
1201813241 Y:18096885-18096907 GGCTGAAGCCGCAGGAGTGCAGG + Intergenic