ID: 1187017885

View in Genome Browser
Species Human (GRCh38)
Location X:15348595-15348617
Sequence TGGGAGGCACTGGAATATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187017885_1187017888 -8 Left 1187017885 X:15348595-15348617 CCCTGATATTCCAGTGCCTCCCA 0: 1
1: 0
2: 0
3: 17
4: 227
Right 1187017888 X:15348610-15348632 GCCTCCCAGTCCCATGCCTTTGG 0: 1
1: 0
2: 1
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187017885 Original CRISPR TGGGAGGCACTGGAATATCA GGG (reversed) Intronic
902166752 1:14578346-14578368 TGAAAGGGACTGAAATATCACGG - Intergenic
904676592 1:32202439-32202461 TTGGGGGCCCTGGAGTATCAGGG + Intronic
904962980 1:34349356-34349378 TAGGAGGCCCTGGAAAACCAGGG + Intergenic
906182687 1:43835498-43835520 TGGAAGGCAGTCCAATATCAAGG - Intronic
906857227 1:49321003-49321025 TGGGAGTGACTGGAACATGAGGG - Intronic
907165442 1:52406424-52406446 TGGTAGGCACTGGACGCTCAGGG + Intronic
908848162 1:68346100-68346122 TGAAAGGCACTGTAAGATCAAGG + Intergenic
909557695 1:76972295-76972317 TGGGAGGCAATTGAATCACAGGG - Intronic
910352840 1:86319224-86319246 TGGGAGGCACTGGAAAAAACTGG + Intergenic
911245546 1:95512387-95512409 TGAGAGACACTGGAATAACTGGG - Intergenic
914355624 1:146881921-146881943 TGGGTGGCACTGGTATCCCATGG - Intergenic
915462764 1:156080123-156080145 TGGGAGGCCCCGGAATTTAATGG - Intronic
919618103 1:199832529-199832551 TGGTAGGCACTGTAATAAGAAGG - Intergenic
920656485 1:207879378-207879400 TGGGGGACCCTGGAGTATCAAGG - Intergenic
921538370 1:216381264-216381286 TGGGAGGCAAAAAAATATCATGG + Intronic
922273925 1:224058978-224059000 TGGCAGGCGCTGGACTATAATGG + Intergenic
1064035694 10:11911785-11911807 TGGGAGGCTATTGAATATCAAGG - Intergenic
1065288093 10:24204235-24204257 TTGGAGCCACTGGAATTTTAAGG + Intronic
1066937732 10:41858839-41858861 TGGAATGCAATGGAATATAATGG + Intergenic
1067485499 10:46646131-46646153 GGGGAGCCAATGGAATATCCAGG - Intergenic
1067609259 10:47695521-47695543 GGGGAGCCAATGGAATATCCAGG + Intergenic
1070909205 10:80102762-80102784 TGGGAGGCAGTGTAGTATAATGG + Intergenic
1071233105 10:83611995-83612017 TGGAAGGCAGAGGAATAACAAGG - Intergenic
1071624849 10:87157167-87157189 GGGGAGCCAATGGAATATCCAGG + Intronic
1072112194 10:92333312-92333334 TACAAGGCACTGGAATATAATGG - Intronic
1078290627 11:10006928-10006950 TGAGAGTCACTGGAAGGTCATGG + Intronic
1078418652 11:11188313-11188335 GAGGAGTCACTGTAATATCATGG - Intergenic
1078551710 11:12285756-12285778 TGGCAGGGAGTGGAATATCTAGG + Intronic
1078619466 11:12893790-12893812 TGGGATGAAGTGGCATATCAGGG + Intronic
1082923357 11:58519896-58519918 TGGCAGGCAGTGGAAAATCTTGG + Intergenic
1083903972 11:65658294-65658316 TGGCAGGTACTGGAATTCCATGG + Exonic
1084701750 11:70790855-70790877 TGTGAGGCTCTGGCACATCAGGG - Intronic
1084865379 11:72051940-72051962 TGGGAGGCACTGAAAAGTCCTGG + Intronic
1085226875 11:74929514-74929536 TGGCAGCGACTGGATTATCAAGG - Intronic
1087045028 11:93837732-93837754 TGGTAGGCACGGGTATACCAGGG + Intronic
1088756342 11:112888403-112888425 TGGGAGGCACAGGAAAAGTAGGG + Intergenic
1089383829 11:118055268-118055290 TTGGAGGCCCTGGAATTTGAGGG - Intergenic
1092524486 12:9301396-9301418 TGGGATGCACTGGAAAGCCATGG - Intergenic
1092542779 12:9430416-9430438 TGGGATGCACTGGAAAGCCATGG + Intergenic
1093661945 12:21767440-21767462 GTGGAGGCACTGGATTCTCATGG + Intronic
1094204045 12:27821860-27821882 TGAGAGGCAGTGTAATATAATGG + Intergenic
1096749196 12:53748042-53748064 TGGGAGCCACTGGAAATTCTGGG - Intergenic
1097298169 12:57989600-57989622 TAGGTGGCATTGGAAGATCAGGG + Intergenic
1099951962 12:89313612-89313634 TGCTAGGCATTGGAATACCATGG + Intergenic
1100110047 12:91229864-91229886 TGGGACAAACTGGAAGATCATGG - Intergenic
1103739983 12:123084473-123084495 TGGGAGGAACTGGAGCACCAGGG + Intronic
1104005512 12:124889464-124889486 TGGCAGGGGCTGGGATATCATGG + Intergenic
1107332016 13:39311658-39311680 TGGGAGGAACTCAAATACCAGGG - Intergenic
1108614839 13:52122124-52122146 AGGGAGGCAATGTAGTATCATGG + Intronic
1108729970 13:53224915-53224937 TGGGAGGTAATTGAATAACAGGG + Intergenic
1109327100 13:60880845-60880867 TAGGAAGCACTGGAGTATGATGG + Intergenic
1110287166 13:73763136-73763158 TGGGAGGGGGTGGAATATAAAGG - Intronic
1111404233 13:87781354-87781376 TGAGAAGCACAGGAAAATCACGG + Intergenic
1113035065 13:106039238-106039260 TGGGAGGTAATTGAATATCGGGG - Intergenic
1113200619 13:107865461-107865483 TGGGAGTCCTTGGAAGATCAGGG - Intronic
1113848824 13:113406710-113406732 TGGGAGGGGCTGGCATTTCATGG + Intergenic
1114949961 14:27737577-27737599 TGGGAGCCACTGGAAGCTTAAGG - Intergenic
1116536342 14:46035845-46035867 TGAGAGGTATTGGATTATCAGGG + Intergenic
1116756180 14:48951039-48951061 TGGGAGGAAATGTAATATGATGG - Intergenic
1117168894 14:53069737-53069759 TGGCAGGTACTGGAATTTGAGGG - Intronic
1118288755 14:64502297-64502319 TGGCAGTCAGTGAAATATCAAGG - Intronic
1118692512 14:68353459-68353481 TGGGAAGTGCTGGAATATCAGGG + Intronic
1118857595 14:69636294-69636316 TCTGAGCCACTGGAATTTCAGGG - Intronic
1121588021 14:95077192-95077214 AGGGAGGCACTGGCAACTCATGG - Intergenic
1121588263 14:95078912-95078934 TGGGAGCCACTGGAATACAAGGG - Intergenic
1122095635 14:99369187-99369209 TGGGAGGTCCTGGAATTGCAAGG - Intergenic
1122374412 14:101248591-101248613 CGGGAGGCACTGGACTAGCAGGG + Intergenic
1125411444 15:39410491-39410513 TGGAAGGAAATGAAATATCATGG + Intergenic
1126669201 15:51101006-51101028 TGGGAGGCACTGGCAGAAGATGG + Intronic
1126740311 15:51770453-51770475 TGGGAGGCACTTGATAAACATGG + Intronic
1127553138 15:60060769-60060791 TGGGGAGCACTGGACTCTCAGGG + Intronic
1128898323 15:71395864-71395886 TGGGAGACACTGGAAAAGGAAGG - Intronic
1129315384 15:74739962-74739984 TGGAAGGCACTGGCATAAGATGG - Intergenic
1129698972 15:77756839-77756861 TGGGGGGCGGTGGAGTATCAGGG - Intronic
1132360097 15:101205286-101205308 TGGGAGGCACTGGAAATTATTGG - Intronic
1133206617 16:4237892-4237914 GGGGAGGCACAGGAAAAGCAAGG - Intronic
1133495250 16:6311754-6311776 TGGGAGTCACTGGATTCCCATGG + Intronic
1134511633 16:14853069-14853091 TGGGAGGCAGTGGTATGTGATGG + Intronic
1134699275 16:16251565-16251587 TGGGAGGCAGTGGTATGTGATGG + Intronic
1134972555 16:18543107-18543129 TGGGAGGCAGTGGTATGTGATGG - Intronic
1135192744 16:20368118-20368140 TGGGAGGTACTGCAATCTCCGGG + Intronic
1135201639 16:20442491-20442513 TGGGAGGAACTGGGGTATCTGGG + Intergenic
1135217469 16:20585375-20585397 TGGGAGGAACTGGGGTATCTGGG - Intergenic
1135609764 16:23856095-23856117 TTGCTGGCACTGGAATATCATGG + Intronic
1135728761 16:24877105-24877127 TGGGATGCAGTGGATTAACAAGG + Intronic
1137865506 16:51891715-51891737 AGGGGGGCACTTGAATATCAAGG + Intergenic
1138659378 16:58508563-58508585 TGGGAGGTCCTGGAAGAGCAGGG + Intronic
1139568181 16:67793031-67793053 TGGCAGGCTCTGGAAAGTCAAGG - Intronic
1139978395 16:70833522-70833544 TGGGTGGCACTGGTATCCCATGG + Intronic
1141284559 16:82659658-82659680 TGCGAGGCACTGGAATACAATGG + Intronic
1143383504 17:6510797-6510819 TGGGAGAGGCTGGAGTATCAAGG + Intronic
1145336213 17:21914920-21914942 TGGAATGCACTGGAATAGAACGG + Intergenic
1145338048 17:21929730-21929752 TGGAATGGACTGGAATATAATGG + Intergenic
1145701618 17:26835205-26835227 TGGAAGGCACTGGAATGGAATGG + Intergenic
1145973331 17:28969797-28969819 CGGGAGGCTCTGGAACCTCAGGG + Exonic
1148216335 17:45835751-45835773 TGGGGGGCACTAGAAGATGAGGG + Exonic
1150552460 17:66223367-66223389 TGTGTGGCATTGGTATATCAGGG - Intronic
1152465618 17:80464541-80464563 TGGGAGGCACTGGAGTCCGAGGG + Intergenic
1203179775 17_KI270729v1_random:47544-47566 TGGAATGGACTGGAATATAATGG + Intergenic
1203181269 17_KI270729v1_random:58806-58828 TGGAATGCAATGGAATATAATGG + Intergenic
1203200827 17_KI270729v1_random:273797-273819 TGGAATGCACTGGAATAGAAAGG + Intergenic
1203210422 17_KI270730v1_random:74498-74520 TGGAATGCACTGGAATAGAAAGG + Intergenic
1154967940 18:21378283-21378305 TGGGTAGCATTGGGATATCAAGG + Intronic
1158120180 18:54040208-54040230 TGGAAGTCACAGGAGTATCAGGG - Intergenic
1159427022 18:68302854-68302876 TGTGAGGCACTGGGTTACCATGG - Intergenic
1159605990 18:70475814-70475836 TGGCTGACACTGGAAAATCAAGG + Intergenic
1164014230 19:21237914-21237936 TGGGAGGCTGTGGAAACTCAGGG + Intronic
925452216 2:3979355-3979377 TGGGAGGCAATGGGACATGAGGG + Intergenic
926036341 2:9638695-9638717 TGGGAGGGGCTGGAAGATCCAGG + Intergenic
926063347 2:9818790-9818812 TGGGAGGGAATGGAATAGAAGGG + Intergenic
928206294 2:29286388-29286410 TGGAAGTCACTGGTATATAATGG - Intronic
929227255 2:39523541-39523563 TGCCAGGCACTGAAATACCAGGG - Intergenic
930147729 2:48024542-48024564 TGGGATGCTCTGGAATACAAAGG - Intergenic
931784109 2:65603781-65603803 TGGGAGACACTTGTATATCTTGG - Intergenic
932820821 2:74898412-74898434 TGGGAGACACTGGATTCTCCAGG + Intergenic
933685523 2:85138263-85138285 TGGGAAGCAGTGGGATATAAAGG - Intronic
937750239 2:125467928-125467950 TGGGAGACACTGGAACATGAAGG + Intergenic
939166659 2:138648090-138648112 TGGGAGGCACCAGCATATCCAGG - Intergenic
939636510 2:144589603-144589625 TAGGAGGCAGTGGAGTATAATGG - Intergenic
942472031 2:176269929-176269951 TGGGAGGTGCTGGAGTATGAGGG + Intronic
942516106 2:176755038-176755060 TAGGATGAACTGGAACATCAGGG - Intergenic
942689985 2:178574941-178574963 TAGGTGGCCCTGGGATATCATGG + Exonic
943957998 2:194217924-194217946 TGTGAGCCACTGAAATATTAGGG + Intergenic
946337935 2:219050724-219050746 TGGGAGGACCTGGAGTGTCAGGG - Intergenic
947166425 2:227267021-227267043 CGGGAGGCCCTGGGATATAAGGG - Exonic
947834557 2:233166195-233166217 TGGGAGGGACTGGAAGCCCAGGG - Intronic
948122174 2:235539255-235539277 TATGATGCACTGGATTATCATGG + Intronic
948718845 2:239883486-239883508 AGGGAGGAACTGGACTATCAGGG - Intergenic
1171931308 20:31231576-31231598 TGGAATGCACTGGAATGTAATGG + Intergenic
1174663572 20:52236518-52236540 TGTCAGGCACTGTAAAATCATGG - Intergenic
1175899978 20:62356130-62356152 TGGGATGCACAGGAAGATCCTGG + Intronic
1176748841 21:10674869-10674891 TGGGATGGACTCGAATATTATGG - Intergenic
1176754489 21:10715794-10715816 TGGAATGGACTGGAATATAATGG - Intergenic
1176756499 21:10729607-10729629 TGGAAGGGACTGGAATTTAATGG - Intergenic
1176970840 21:15263705-15263727 TGGGAGGTACTGGCAGCTCAAGG + Intergenic
1178390645 21:32195416-32195438 TGGAAGCCACTGGAATTTAAAGG - Intergenic
1182038160 22:27215641-27215663 TGGGAGGCAGTGGAAGCTGATGG - Intergenic
1183240429 22:36653693-36653715 TGGAAGGCTCTGGAATCTCTGGG + Intronic
1183804953 22:40200869-40200891 TGAGAGGCAGTGGAATGTGATGG + Intronic
1184153417 22:42651270-42651292 TGGAAAGAACTGGAATGTCAAGG + Intergenic
1203314359 22_KI270736v1_random:172889-172911 TGGGATGGAATGGAATATCATGG + Intergenic
949534345 3:4984250-4984272 TAGCAGGCACTGGCATAGCACGG + Exonic
953774466 3:45803628-45803650 AGGGAGGCACTGGGAAAACAGGG - Intergenic
953799918 3:46014920-46014942 CAGGAGACACTGGAACATCATGG + Intergenic
955763339 3:62313940-62313962 TGAGAGCCACTGGAAAATCATGG + Intergenic
956675470 3:71728368-71728390 TGGCAGGAACTAGAATTTCAAGG + Intronic
957908603 3:86590994-86591016 TGCTAGGCAGTGGAATATAAGGG + Intergenic
958804653 3:98795238-98795260 TGGGAAACACTGGAAAACCATGG + Exonic
959375664 3:105585902-105585924 TGGGATGCAGAGGAATTTCAAGG - Intergenic
959868688 3:111301870-111301892 AGGGACACAGTGGAATATCAGGG + Intronic
960197607 3:114788980-114789002 TGGGAGGTACTTGAATCACAGGG - Intronic
961545989 3:127633659-127633681 TGCTAGGCACTGGAATTACAGGG + Intronic
962219198 3:133549486-133549508 TGGTAGGCCCTGGAGGATCATGG - Intergenic
962614768 3:137114042-137114064 TGGGAGGCAAAGGACTAGCAAGG + Intergenic
965252994 3:166367115-166367137 TGGGTGGCAATGGGATGTCAAGG - Intergenic
966624718 3:182003469-182003491 TGGGAGGCACTGCAAGGTGAAGG + Intergenic
967339456 3:188380146-188380168 TAAGAGGCAGTGGAATATGAGGG - Intronic
968953052 4:3704399-3704421 GGGGAGGCCCTGGAATTGCAGGG - Intergenic
973354181 4:49121721-49121743 TGGAAAGGACTTGAATATCATGG - Intergenic
973355406 4:49129017-49129039 TGGAAAGGACTTGAATATCATGG - Intergenic
973403821 4:49655061-49655083 TGGAAAGGACTGGAATATAATGG + Intergenic
974656585 4:64831485-64831507 TGGGAGGAAATTGAATCTCAGGG + Intergenic
978415299 4:108468599-108468621 AGGGAGGCTCAGGAATATTAGGG - Intergenic
981155916 4:141434822-141434844 TAGGAGGCACTGAAAAAACATGG - Intergenic
981635921 4:146878888-146878910 TGGGGGGCTCTGGAATTCCATGG + Intronic
982640249 4:157949912-157949934 TGGGAGTCACTAAAATATAAAGG - Intergenic
983633444 4:169873565-169873587 TGGGAGCCAATGGAGTTTCATGG + Intergenic
985539915 5:483086-483108 TGGGAGGCTCTGGAACCCCAAGG - Intronic
989152761 5:38316664-38316686 TGGAAGGCAGTGGAGTGTCATGG - Intronic
990776904 5:59313437-59313459 TGGGAGAAACTGGGATATTAGGG - Intronic
991723192 5:69513214-69513236 TGGGAGGCACTTGAAGTTGAGGG - Intronic
993643797 5:90437692-90437714 TGTTAGGCACTGGAATTACAAGG - Intergenic
996756831 5:126944530-126944552 TGGAATGCAATGGCATATCAGGG - Intronic
998127908 5:139636568-139636590 TGGAAGGGACTGGACTAACATGG + Intergenic
998733733 5:145110889-145110911 TGAGAGGCAATGCAATATCAAGG - Intergenic
1000437707 5:161233349-161233371 TGGGAGGCACTGGTATTTTGAGG + Intergenic
1002356660 5:178635180-178635202 CTGGAGGCACTCGAATAGCATGG - Intergenic
1002590116 5:180285301-180285323 TGGGAGGAACTTGAATATTGTGG - Intronic
1003167849 6:3696941-3696963 AGGGAGGCAGTGGGAAATCATGG + Intergenic
1003889125 6:10548325-10548347 TGGGAGGCCCAGGAATATCTTGG - Intronic
1004239763 6:13909985-13910007 TGGAAGACACTGGAATAAAAGGG + Intergenic
1010550612 6:77217955-77217977 TGAGGGGTACTGGAATCTCAAGG - Intergenic
1011895069 6:92215516-92215538 TTGGAGGCACTGGACTCCCAAGG + Intergenic
1012125859 6:95427516-95427538 TGGGAGGTAATTGAATGTCAGGG + Intergenic
1015222056 6:130815050-130815072 TGAGAGGCAGTGGAATATAGTGG + Intergenic
1017720495 6:157240314-157240336 TGGGAGGGTCTGGAATAAGAGGG - Intergenic
1019572759 7:1720650-1720672 TGAGATGCACTGGAATAGGAAGG - Intronic
1020004701 7:4776077-4776099 TGTGAGGCACTGAAATCTCCCGG - Intronic
1020498526 7:8887745-8887767 TGGGAGGCAATTTAATACCATGG + Intergenic
1026894637 7:74003039-74003061 TGGGAGGCAGTGGAGGGTCAGGG + Intergenic
1027347427 7:77275707-77275729 TAGGAGGCCCAGGAAAATCATGG - Intronic
1029258865 7:99287787-99287809 AGCGAGGTACAGGAATATCAGGG + Intergenic
1031592038 7:123604977-123604999 TTGGAGGCAGTTGAATATAACGG - Intronic
1031926768 7:127646340-127646362 GGGGAGGCACTGCAATTTTAAGG + Intergenic
1031954748 7:127930792-127930814 TTGGAGGCACAGGCATATCCAGG + Intronic
1032767961 7:135018354-135018376 TGGGAGGCACTTGTAGAACATGG - Intronic
1033012311 7:137635601-137635623 TGAGATCCACTGGACTATCACGG + Intronic
1034096754 7:148415737-148415759 AGGCAGGCAATGGAATATAATGG + Exonic
1036697362 8:10985503-10985525 TGGGAGGCAGTAGAGTGTCACGG - Intronic
1037924788 8:22835635-22835657 TGGGAGGCTGTGGAAGATCCTGG - Intronic
1038661755 8:29503650-29503672 TGGGAGTCACTGAGATTTCATGG - Intergenic
1039325721 8:36483446-36483468 TGTGCCACACTGGAATATCAAGG + Intergenic
1039667709 8:39553680-39553702 TGGGAGGAAATGGAATACAATGG + Intergenic
1040022963 8:42756991-42757013 TGGGATCCAATGGAATATGATGG - Exonic
1041184510 8:55285282-55285304 TGTCAGGGACTTGAATATCATGG + Intronic
1041956700 8:63564257-63564279 TGAGAGGCACATGAATCTCAGGG + Intergenic
1042340345 8:67672369-67672391 TGGGTTGCACAGGAATATAATGG - Intronic
1042535385 8:69853412-69853434 TGGGAGGGACTGAAATAGGATGG + Intergenic
1044214708 8:89595490-89595512 TGGGAGTCACAGGGATGTCATGG + Intergenic
1044543333 8:93431780-93431802 TGGTAGCCACTGGCATATCTTGG + Intergenic
1045563132 8:103285091-103285113 TGGGTGAGACTGGAATATAATGG - Intergenic
1045745419 8:105413871-105413893 TGGGAAGCTCTGGAATAAAAAGG + Intronic
1045828353 8:106428150-106428172 TGGGAAGCACAGGGATACCATGG + Intronic
1047353028 8:124094198-124094220 TGAGAGGACCTGGAAAATCAGGG - Intronic
1048090855 8:131238649-131238671 TGTGAGGCACTGGATACTCAAGG - Intergenic
1048572979 8:135670219-135670241 TGGGTGGCACTTGAATGTCCTGG + Intergenic
1049696353 8:143985999-143986021 TGTCAGGCATTAGAATATCAGGG + Intronic
1049906929 9:226482-226504 TGGGAGGCAGTGGAGAATCCAGG + Intronic
1051752373 9:20356623-20356645 TGGGAGGCAGCGGGATATGATGG - Intronic
1052263888 9:26549304-26549326 TGGAAGGCACAAGAAGATCAGGG + Intergenic
1053016663 9:34665835-34665857 TGGGAGGCACTGGAAGTTAAGGG + Exonic
1056079274 9:83073597-83073619 TGGAAGCCACTGCAATATCCTGG + Intergenic
1061524165 9:131144483-131144505 TCGGAGCCACTGGAATATGAAGG - Exonic
1061597754 9:131643155-131643177 TTGGTGGCACTGGAAACTCAAGG - Intronic
1061722467 9:132561191-132561213 TGAGAGGCACTTGAAAATTATGG - Intronic
1203725555 Un_GL000216v2:46755-46777 TGGAAAGGAATGGAATATCATGG - Intergenic
1203389038 Un_KI270438v1:80646-80668 TGGGAGGGACTGGAGTGTAATGG + Intergenic
1203414594 Un_KI270589v1:43613-43635 TGGGATGGACTGGAATAGAATGG - Intergenic
1203673957 Un_KI270756v1:5702-5724 TGGAATGCACTGGAATAGAAAGG - Intergenic
1186847182 X:13542430-13542452 TGGTAGGAACTGGACAATCATGG - Intergenic
1187017885 X:15348595-15348617 TGGGAGGCACTGGAATATCAGGG - Intronic
1188661375 X:32762916-32762938 TAGGAGGCTATGGAATATGATGG + Intronic
1189919508 X:45889446-45889468 TGAGAGGCAATGGAATCGCATGG + Intergenic
1192558748 X:72110866-72110888 TGGGAGGAACTCGAATTTCCAGG - Intergenic
1196680833 X:118467830-118467852 TTGGAGGGACTGGATAATCAAGG + Intergenic
1198029069 X:132737494-132737516 TGGGAGGAACTAGAAGATAAAGG - Intronic
1201099226 Y:10658753-10658775 TGGAATGCAATGGAATAGCATGG - Intergenic
1201102592 Y:10689353-10689375 TGGAATGCAATGGAATAGCATGG - Intergenic
1201105992 Y:10763680-10763702 TGGGGTGCAATGGAATATCATGG - Intergenic
1201134543 Y:10980591-10980613 TGGAAGGCACTGGAATTTAGTGG - Intergenic
1201174232 Y:11298086-11298108 TGGAAGGAAATGGAATATAATGG - Intergenic
1201207633 Y:11647919-11647941 TGGAAGGGACTGGAATACAATGG + Intergenic
1201216538 Y:11727640-11727662 TGGAAGGGATTGGAATATAATGG + Intergenic
1201216926 Y:11731069-11731091 TGGAATGCACTGGAATATAAAGG + Intergenic
1201218637 Y:11745482-11745504 TGGAATGGACTGGAATATAACGG + Intergenic