ID: 1187018801

View in Genome Browser
Species Human (GRCh38)
Location X:15358177-15358199
Sequence CTGCAGTTATAGATGAAGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 239}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187018801_1187018805 7 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018805 X:15358207-15358229 GAAAGCTCACTGGGGCTAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 119
1187018801_1187018803 -2 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018803 X:15358198-15358220 AGAGAGAAAGAAAGCTCACTGGG 0: 1
1: 0
2: 9
3: 97
4: 798
1187018801_1187018808 21 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018808 X:15358221-15358243 GCTAGCAGGTGGAATGGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
1187018801_1187018806 10 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018806 X:15358210-15358232 AGCTCACTGGGGCTAGCAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 206
1187018801_1187018804 -1 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018804 X:15358199-15358221 GAGAGAAAGAAAGCTCACTGGGG 0: 1
1: 0
2: 10
3: 70
4: 706
1187018801_1187018802 -3 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018802 X:15358197-15358219 CAGAGAGAAAGAAAGCTCACTGG 0: 1
1: 0
2: 5
3: 90
4: 737
1187018801_1187018807 15 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018807 X:15358215-15358237 ACTGGGGCTAGCAGGTGGAATGG 0: 1
1: 0
2: 1
3: 28
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187018801 Original CRISPR CTGCAGTTATAGATGAAGAA TGG (reversed) Exonic