ID: 1187018801

View in Genome Browser
Species Human (GRCh38)
Location X:15358177-15358199
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 239}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187018801_1187018808 21 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018808 X:15358221-15358243 GCTAGCAGGTGGAATGGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 106
1187018801_1187018805 7 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018805 X:15358207-15358229 GAAAGCTCACTGGGGCTAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 119
1187018801_1187018804 -1 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018804 X:15358199-15358221 GAGAGAAAGAAAGCTCACTGGGG 0: 1
1: 0
2: 10
3: 70
4: 706
1187018801_1187018802 -3 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018802 X:15358197-15358219 CAGAGAGAAAGAAAGCTCACTGG 0: 1
1: 0
2: 5
3: 90
4: 737
1187018801_1187018806 10 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018806 X:15358210-15358232 AGCTCACTGGGGCTAGCAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 206
1187018801_1187018803 -2 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018803 X:15358198-15358220 AGAGAGAAAGAAAGCTCACTGGG 0: 1
1: 0
2: 9
3: 97
4: 798
1187018801_1187018807 15 Left 1187018801 X:15358177-15358199 CCATTCTTCATCTATAACTGCAG 0: 1
1: 0
2: 1
3: 32
4: 239
Right 1187018807 X:15358215-15358237 ACTGGGGCTAGCAGGTGGAATGG 0: 1
1: 0
2: 1
3: 28
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187018801 Original CRISPR CTGCAGTTATAGATGAAGAA TGG (reversed) Exonic
900033103 1:385464-385486 CTGGAGTTAGAGATAATGAAAGG - Intergenic
900053944 1:615354-615376 CTGGAGTTAGAGATAATGAAAGG - Intergenic
902395715 1:16131651-16131673 CTGCAGTTTGAGATGAGTAAAGG + Intronic
903826013 1:26146209-26146231 TTGCAGTTATAGTGGAACAAAGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
906129942 1:43450080-43450102 CTGCAGTGAAAGATGAGGAGGGG - Intronic
906185756 1:43860730-43860752 CTGGAGTGCTAGATGCAGAAAGG + Intronic
907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG + Exonic
908035512 1:60047151-60047173 CTGAAGTAATAGTTGATGAAGGG - Intronic
908350350 1:63280789-63280811 CTGCAGTTATAGGTAAAGTTGGG - Intergenic
910936596 1:92487816-92487838 CTGCATTTATATATAAAGAAGGG - Intergenic
911260254 1:95677538-95677560 CTGCAGTGAGAAATGAAGCATGG + Intergenic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
912079134 1:105913217-105913239 CTGGACTTATAGAGGGAGAAAGG - Intergenic
913975097 1:143449689-143449711 ATGCAGTTAAGGATGAAGAAGGG + Intergenic
914069489 1:144275305-144275327 ATGCAGTTAAGGATGAAGAAGGG + Intergenic
914109666 1:144691049-144691071 ATGCAGTTAAGGATGAAGAAGGG - Intergenic
916714894 1:167440272-167440294 CCCCAGTTACAGATGAGGAAAGG + Intronic
916840823 1:168598864-168598886 ATGAAGTTGTAGATGAGGAAAGG - Intergenic
917297105 1:173531675-173531697 AGACAGTTGTAGATGAAGAAAGG - Intronic
918036239 1:180874951-180874973 CTTCAGTGATAGATAAATAACGG + Intronic
919214924 1:194540947-194540969 CTGCTTTTATAAATGAAGTAAGG - Intergenic
921422860 1:214968529-214968551 CTTCACTTAGAGATGAAGATTGG + Intergenic
921720079 1:218461464-218461486 AAGCAGTTGTAGATGAATAAAGG - Intergenic
922255462 1:223889615-223889637 CTGGAGTTAGAGATAATGAAAGG - Intergenic
924032671 1:239902311-239902333 CTAGTTTTATAGATGAAGAAAGG + Intronic
924336666 1:242992484-242992506 CTGGAGTTAGAGATAATGAAAGG - Intergenic
924445519 1:244126512-244126534 ATGCAGGTATGGATGAAGTAAGG + Intergenic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1068549895 10:58394791-58394813 CTGCCTTTATACATGTAGAATGG + Intronic
1068681575 10:59825955-59825977 CTGCAGCTGTAGATGATGAGGGG + Intronic
1068793577 10:61053260-61053282 CTGGACATAAAGATGAAGAATGG + Intergenic
1072556316 10:96516632-96516654 CTGCAGTTATAGACCAGAAAGGG - Intergenic
1073676047 10:105648182-105648204 CTGCATTTTTTGAGGAAGAAAGG - Intergenic
1073699260 10:105907122-105907144 CTGCTGTTATAGATTAAGAATGG + Intergenic
1074904042 10:117844971-117844993 CTGCAGTTATAGAGCAAAAGGGG + Intergenic
1078713674 11:13818884-13818906 AGGCAATTATAGAAGAAGAAAGG + Intergenic
1081019012 11:37919829-37919851 TTGCATAGATAGATGAAGAATGG - Intergenic
1082244156 11:49901899-49901921 CTGAAGTTATAGACTAACAAAGG + Intergenic
1082263741 11:50097648-50097670 GGGCAGTAATAGGTGAAGAATGG - Intergenic
1082566109 11:54680149-54680171 CTGAAGTTATAGACTAACAAAGG - Intergenic
1083133902 11:60653698-60653720 TAGCAGTTATAGAGGATGAATGG - Intergenic
1090675211 11:128986053-128986075 CAGCAGCAACAGATGAAGAAAGG - Exonic
1090908510 11:131097772-131097794 CCCCAGTTACAGATGAGGAAGGG + Intergenic
1091424790 12:378077-378099 CTACTGTTAAAGATGGAGAATGG - Intronic
1091685109 12:2555972-2555994 CGCAAGTTAGAGATGAAGAAAGG - Intronic
1093334638 12:17888297-17888319 GTGCAGATATAGATCCAGAATGG + Intergenic
1093859884 12:24152037-24152059 CTTCAGTGATAGAGGAAGACTGG - Intergenic
1094020970 12:25913812-25913834 TTGCAATCATTGATGAAGAATGG - Intergenic
1095119583 12:38401029-38401051 CTGAAGTTCTAGATGAACAGAGG + Intergenic
1096869255 12:54583232-54583254 CTTCAGAGATAGATGAAGACCGG - Exonic
1098244162 12:68499174-68499196 CTTCAGTTATTGATGAAAATAGG + Intergenic
1100381970 12:94070779-94070801 GTGCAGTTATAGGTGCACAAGGG + Intergenic
1100590945 12:96028544-96028566 CTACACTTAAAGATGAGGAAAGG - Intronic
1101341863 12:103849197-103849219 CTGTAGTAAAAGATGAAGAATGG - Intergenic
1102927229 12:116835614-116835636 CTGGAGTGCTAGATGGAGAAGGG + Intronic
1103097818 12:118146152-118146174 CTGCAGTGAAAGATGGGGAAGGG - Intergenic
1103201435 12:119091180-119091202 CTGCAGTTCTAGCTGATGACAGG + Intronic
1106631961 13:31483569-31483591 CTGCAGAGATAGAAGTAGAAGGG + Intergenic
1108887672 13:55208169-55208191 CTGCAATTATAGAAGAAGACTGG + Intergenic
1108888310 13:55219644-55219666 CTGCATTTATAGAAAAAGAAAGG + Intergenic
1110284805 13:73737243-73737265 CTACAGTTGTAGCTGAAGAAAGG - Intronic
1110671800 13:78189410-78189432 CTCTACTTTTAGATGAAGAAAGG - Intergenic
1112324877 13:98437407-98437429 AGACAGTTATAGATAAAGAAAGG + Intronic
1115290058 14:31760488-31760510 TGGCAGTTATAGTGGAAGAATGG - Intronic
1115450630 14:33543250-33543272 TTCCAGTTATATATGAAGAGGGG + Intronic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116665161 14:47765398-47765420 CTGCAGTAATAGATGGAGTGGGG + Intergenic
1117363521 14:55001771-55001793 CTGAAATTTTAGAGGAAGAAAGG - Intronic
1119832150 14:77712744-77712766 CTACAGTTAAAGATGAATTATGG - Intronic
1125308413 15:38349945-38349967 CTGCATTTATGGATGATGTAAGG + Intronic
1126316568 15:47376296-47376318 ATGCAGGTTGAGATGAAGAAAGG - Intronic
1126342370 15:47655128-47655150 CTTCAGTAAGAGATCAAGAAAGG - Intronic
1126343607 15:47670036-47670058 CTCCAGTTGGAGAAGAAGAAAGG - Intronic
1127148897 15:56053723-56053745 CTGCAGCTCTAGATGATAAAAGG + Intergenic
1127182069 15:56431424-56431446 ATGCAATTATTGAAGAAGAAAGG - Exonic
1128193782 15:65731470-65731492 TTGCAGTTATTAATGAAAAAAGG - Intronic
1130140078 15:81218417-81218439 TTGCATTTATAGATGAATTAGGG - Intronic
1130788455 15:87125772-87125794 CTACAGTTATTGATGGAGATTGG - Intergenic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1141054278 16:80802749-80802771 CTGGCGTTAGAGAAGAAGAATGG - Intronic
1141455093 16:84136060-84136082 CTGCAGGTGGAGCTGAAGAAGGG - Intronic
1142797670 17:2321376-2321398 CTGCAGTGATAGCTGGACAAGGG + Exonic
1143665857 17:8359673-8359695 CTGCACCTACAGATGAAGAAGGG + Intergenic
1143752584 17:9040086-9040108 CTGCAGATATAGATGTAAAGTGG - Intronic
1144166085 17:12612095-12612117 CTACAGTTCTAGATGAGAAAGGG - Intergenic
1144894758 17:18521669-18521691 CTACAGTGCTAGATGAAGACAGG + Intergenic
1144944436 17:18962568-18962590 CTGCAGTGAGAGATGAGGCAAGG + Intronic
1145823960 17:27862604-27862626 CTGCAGATAGAGTTCAAGAAAGG + Intronic
1146386400 17:32379639-32379661 CTGGAGTTAGAGTGGAAGAAGGG + Exonic
1149871663 17:60187664-60187686 CTACAGTGCTAGATGAAGACAGG + Intronic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1153956859 18:10103854-10103876 CTAATGTTAGAGATGAAGAAAGG - Intergenic
1155708559 18:28847248-28847270 CTGCAGTTACAGTGGAAGAGAGG - Intergenic
1155724569 18:29063758-29063780 ATGCAGACATAGATGGAGAAGGG - Intergenic
1156651541 18:39232605-39232627 CTGCATTTATAAAGAAAGAAAGG - Intergenic
1157037645 18:43995188-43995210 ATGCAGTTGTAGATTAATAATGG + Intergenic
1158032363 18:52981852-52981874 AAACAGTTATAGATGAATAATGG + Intronic
1158050770 18:53216024-53216046 CTACATTTATAAAGGAAGAATGG - Intronic
1158399451 18:57108281-57108303 ATCCAGTTACAGAGGAAGAAAGG + Intergenic
1158594573 18:58804871-58804893 CTGTAGTTAGAGAAGAAGAAAGG - Intergenic
1159120678 18:64165787-64165809 TTCCAGTTATGGATAAAGAAAGG + Intergenic
1160174272 18:76579992-76580014 ATGCAATAATAGATGAAGAAAGG - Intergenic
1162023973 19:7883263-7883285 CTGCAGGTATAGATGCTGAGTGG - Intergenic
1162760346 19:12885250-12885272 CTGTAGTTACAGGGGAAGAAGGG - Intronic
1164786472 19:30935132-30935154 CTGAAGTTTGAGATAAAGAACGG + Intergenic
1166767190 19:45258740-45258762 CTGCAGTGAGGGTTGAAGAAGGG + Intronic
925505644 2:4560245-4560267 ATGCAGTGATAGAACAAGAATGG - Intergenic
927376427 2:22420186-22420208 ATGGAGTAATAGATGAAGTAAGG - Intergenic
928390936 2:30910515-30910537 CTACATTGAGAGATGAAGAATGG - Exonic
929412389 2:41711602-41711624 CAATAGTTATAGATGAAGAATGG - Intergenic
929524489 2:42687868-42687890 CTGGAGTCAGAGATGAAGAAGGG - Intronic
929605253 2:43229633-43229655 CTGAAATTATAAATGAAAAATGG + Intergenic
930262195 2:49160853-49160875 CTGCAGTATTAGATGCAAAAGGG + Intergenic
931322808 2:61188317-61188339 CTGCAGAGATAGAAGTAGAAGGG + Exonic
931698376 2:64889167-64889189 CTGCAGTTATTGAGGCAGTATGG - Intergenic
931717783 2:65042898-65042920 CTGCAGTTATAGATCATTACTGG + Intergenic
933166808 2:79085596-79085618 CGGCGGTTCTAGATGGAGAAGGG + Exonic
934179800 2:89610662-89610684 ATGCAGTTAAGGATGAAGAAGGG + Intergenic
934290090 2:91684923-91684945 ATGCAGTTAAGGATGAAGAAGGG + Intergenic
936342756 2:111651169-111651191 TTGCAGTTATAGATGATTAGGGG - Intergenic
936958975 2:118053518-118053540 CTGCAGTTATCAATGAGGTAAGG - Intergenic
937671608 2:124543581-124543603 GTGAAGTTATTGAAGAAGAAAGG + Intronic
939500357 2:142976036-142976058 CGACAGTCATAGGTGAAGAAAGG + Intronic
940053304 2:149487040-149487062 TAGCAGTTATTGCTGAAGAATGG - Intergenic
940986322 2:160055706-160055728 CTTCTTTTACAGATGAAGAAGGG - Intronic
941616072 2:167721295-167721317 ATGCAGTTAAAGCTGAGGAAAGG + Intergenic
942325468 2:174772649-174772671 CAGCTGTTCTAGATGAAGGAAGG - Intergenic
943288504 2:186037330-186037352 CTGCAGTTATTGCAGAACAAAGG + Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943616012 2:190093644-190093666 ATGAAATTATGGATGAAGAAGGG - Intronic
944347185 2:198683650-198683672 CTGCTGTTATAGATCATAAATGG - Intergenic
945538822 2:211056605-211056627 GTGCAGATAGAGATGAAAAATGG - Intergenic
945662812 2:212707249-212707271 CTGCAGATATAGATTATGATAGG - Intergenic
946676997 2:222170869-222170891 ATGCATTTATAGAAGAAGATGGG - Intergenic
947185478 2:227451479-227451501 CAGCAGTCCTAGGTGAAGAAAGG + Intergenic
947508148 2:230725575-230725597 CCGAAGTTATACATGTAGAAAGG + Intronic
947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG + Intronic
1170156774 20:13276079-13276101 TGGCAGTTATCGAGGAAGAAGGG + Intronic
1170238813 20:14139331-14139353 CTCCTTTTATAGATGAAGAAAGG + Intronic
1170238973 20:14141401-14141423 CTCCTTTTATAGATGAAGAAAGG - Intronic
1170539141 20:17370791-17370813 CTGCAGTTATGGAGGAGGCAGGG - Intronic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1171180948 20:23089975-23089997 CTGCATTTATAGATGAGAAGTGG - Intergenic
1173083491 20:39892200-39892222 CTGCAGCTCTAGAAGAAGCATGG + Intergenic
1173151357 20:40569069-40569091 CTGCAGATGGAGATGTAGAAAGG - Intergenic
1175553834 20:59833765-59833787 AGGCAGTTATAGGTAAAGAAAGG + Intronic
1178023818 21:28441641-28441663 CTGAAGTTATAGGTGAGGAAGGG + Intergenic
1179028392 21:37699371-37699393 CTGCAGTAATAGAGGAGGAGTGG - Intronic
1181685153 22:24523081-24523103 CTGCAAATAGAGATGCAGAAAGG + Intronic
1184381060 22:44145219-44145241 CTGCCTTTATGGAGGAAGAAAGG + Intronic
1184526954 22:45029807-45029829 CTCAGTTTATAGATGAAGAAAGG + Intergenic
1184529123 22:45043278-45043300 CTGCAGTTTTAGTTGCAGGATGG + Intergenic
1185103717 22:48855503-48855525 CTGCAGGTATCAAAGAAGAAAGG + Intergenic
950674123 3:14544491-14544513 CTGGAGTCAGAGATGAAGGACGG - Intergenic
955719417 3:61865720-61865742 CTGAAGTTATTTATGAAGAGAGG - Intronic
955815275 3:62835962-62835984 ATGCAGTTGTAGATAAATAAGGG - Intronic
955976914 3:64488756-64488778 CTGCTTTTACAGAGGAAGAAAGG - Intergenic
959717242 3:109446017-109446039 TTGAACTTATAGAGGAAGAAGGG + Intergenic
959793478 3:110393473-110393495 CTGAATCTATAGATAAAGAAGGG - Intergenic
961833354 3:129636681-129636703 GGGCAGGTATAGATGAAGCAGGG + Intergenic
962690572 3:137893485-137893507 CTGGATTTTTAGATGAAGTAAGG + Intergenic
968049735 3:195646283-195646305 CTGCAGCTAGAGATGCAGACAGG + Intergenic
968304398 3:197639699-197639721 CTGCAGCTAGAGATGCAGACAGG - Intergenic
969598909 4:8164177-8164199 CTGTATTTAGAGATGAAGAAAGG - Intergenic
969829479 4:9782960-9782982 ATGCAGTTAAGGATGAAGAAGGG - Exonic
970090528 4:12402071-12402093 CTCCAGTTATTTGTGAAGAAAGG + Intergenic
972473474 4:39429348-39429370 CTTTAGAAATAGATGAAGAAGGG - Intronic
974625056 4:64415557-64415579 CTGCACTTATATTTGGAGAATGG + Intergenic
974840521 4:67294504-67294526 CTGGATTTAAAGATAAAGAAAGG - Intergenic
974878501 4:67725348-67725370 CTGCAGTCATAGCTGAAGCCTGG - Intergenic
974978241 4:68918793-68918815 CAGCAGTTATAAATGCTGAATGG + Intergenic
976734776 4:88298429-88298451 AGGCAGTTGTAGATAAAGAAAGG - Intergenic
977087905 4:92628306-92628328 CAGCAGTAAAAGATTAAGAAGGG + Intronic
978484875 4:109241175-109241197 TTGCATTTATAGATTAAAAAAGG - Intronic
979240462 4:118442825-118442847 CTGGAGTTAGAGATAATGAAAGG + Intergenic
980459643 4:133091313-133091335 CTGTAGATATATATGTAGAATGG - Intergenic
981284546 4:143000577-143000599 ATGCAGTTATAAATGATGAGTGG - Intergenic
983301843 4:165935624-165935646 TTGCAGTTACATTTGAAGAATGG - Intronic
987919023 5:24254272-24254294 CTTCATTCATAGCTGAAGAAAGG - Intergenic
988577511 5:32442065-32442087 CTACAGATAGAAATGAAGAAAGG - Intronic
990236065 5:53768952-53768974 ATACATTTATAGCTGAAGAAGGG - Intergenic
993121554 5:83780604-83780626 CTGCTGTCATAGATGTAAAATGG - Intergenic
994840258 5:104914968-104914990 CTGCAGTTATATAGCAAAAAAGG + Intergenic
996216403 5:120871860-120871882 ATGGATTTATAGAGGAAGAAAGG - Intergenic
996445399 5:123543405-123543427 CTACAGTGTTAAATGAAGAATGG - Intronic
998696521 5:144646812-144646834 CTGCAGTGGCAGCTGAAGAATGG - Intergenic
1000108717 5:158086412-158086434 CAGCAGGGATAGATGAACAAAGG - Intergenic
1001669975 5:173465763-173465785 CTGCAGCTTTAGACCAAGAAAGG - Intergenic
1001902243 5:175442219-175442241 ATGCAGTTCAAGATGAAGAAAGG + Exonic
1002740717 5:181433404-181433426 CTGGAGTTAGAGATAATGAAAGG + Intergenic
1002780356 6:360413-360435 CTTCAGTTATCTTTGAAGAAAGG - Intergenic
1002824079 6:756926-756948 CTGCATTTGGAGATGAAGGAAGG + Intergenic
1003004690 6:2369880-2369902 CTTCAGTTAAGGATGTAGAAGGG + Intergenic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1003674658 6:8192217-8192239 CGGCAGTTATAGATGAAGGCGGG - Intergenic
1007020829 6:38519428-38519450 ATGCAGTGACAGATGAAGACAGG + Intronic
1007953457 6:45894482-45894504 ATAAAGTTATAGATGAAAAAGGG + Intergenic
1007957849 6:45933464-45933486 CTGCAGTTACAACTGATGAAGGG + Intronic
1010011526 6:71052618-71052640 AGACAGTTATAGATAAAGAAAGG - Intergenic
1010434797 6:75816931-75816953 CTGCAGTCATACCTGAAGGAAGG + Intronic
1010658604 6:78542660-78542682 CTGCAGTTATCTAGGCAGAAAGG + Intergenic
1011420573 6:87167892-87167914 CTGCCTTTATAGGTAAAGAAAGG - Intronic
1012149809 6:95734083-95734105 CTTTAGTTGTAGATGAACAATGG - Intergenic
1012380994 6:98619475-98619497 CTACATCTACAGATGAAGAAAGG + Intergenic
1014706694 6:124756258-124756280 TTTCAGTTAGAGATGAGGAAGGG - Intronic
1015452533 6:133387927-133387949 CTGCAGATATGGATGCAGATGGG + Intronic
1016822602 6:148360734-148360756 CTGCAGTTATTTATGGAGCATGG + Intronic
1018572305 6:165224470-165224492 CTGCAGATATAGCTGGAGAAGGG - Intergenic
1018847391 6:167565089-167565111 CTGCAGTCATAGAAGCAGACAGG - Intergenic
1018891291 6:167985209-167985231 CTGCAGTTGTCCATGAAGAGAGG + Intergenic
1019056898 6:169230445-169230467 CAGCACTTACAGATTAAGAAAGG + Intronic
1019245826 6:170709000-170709022 CTGGAGTTAGAGATAATGAAAGG + Intergenic
1020223658 7:6262080-6262102 CAGCAATTACAGCTGAAGAAAGG + Intronic
1020966337 7:14874087-14874109 CTCCAGTTGAAGATGAAGAAGGG + Intronic
1024422324 7:49183153-49183175 ATGCAGTTCAGGATGAAGAAGGG - Intergenic
1024921918 7:54566206-54566228 CAGCAGGTCTAGATGAAGAGAGG - Intronic
1024985949 7:55193304-55193326 CTGCAGGGATAAAAGAAGAAAGG + Intronic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1028668710 7:93376060-93376082 CTGCAAGGATAAATGAAGAAAGG - Intergenic
1029578094 7:101417280-101417302 CTGGAGGTATGGATGAAGAATGG + Intronic
1030114303 7:106051428-106051450 CACCAGTAAAAGATGAAGAAGGG - Intergenic
1032314717 7:130825140-130825162 CTCCAGTTTTAGATGGAGGATGG + Intergenic
1032349731 7:131149601-131149623 CTTCAGGTTTAGTTGAAGAATGG - Intronic
1033984165 7:147202465-147202487 AAACATTTATAGATGAAGAAAGG + Intronic
1034142161 7:148830843-148830865 CAGCAGTTATAGATAAAGACTGG + Intronic
1034190462 7:149209456-149209478 CTGCAGTCCTTGATGAAGACAGG - Intronic
1034307200 7:150053813-150053835 CTGCAGTTACAAATAAAGGAAGG + Intergenic
1034799647 7:154046870-154046892 CTGCAGTTACAAATAAAGGAAGG - Intronic
1034942556 7:155240383-155240405 CTCCTGTAAAAGATGAAGAATGG + Intergenic
1035502297 8:99198-99220 CTGGAGTTAGAGATAATGAAAGG - Intergenic
1036466940 8:9006933-9006955 CTGTAATTATAGATCAAGGAAGG - Intronic
1036508635 8:9379864-9379886 CTGCAGCTTTAGAAGAACAAAGG - Intergenic
1038148162 8:24917408-24917430 CTGAAGTTAAAGAAGAGGAAGGG + Exonic
1039533294 8:38284118-38284140 CTGCAGTTACAGATGAATTTTGG - Intronic
1042794302 8:72643754-72643776 CTGGACTTATACATGAACAAAGG + Intronic
1044446856 8:92288376-92288398 CTGGAATTCTATATGAAGAATGG - Intergenic
1045711558 8:104990481-104990503 ATGAAGGCATAGATGAAGAAAGG - Intronic
1048483455 8:134825013-134825035 CCATAGTTATAGATGGAGAAGGG - Intergenic
1048634340 8:136279655-136279677 CTGATGTTAGAGATGAGGAAAGG + Intergenic
1049582491 8:143418952-143418974 CTGCATTTGAAGATGAAGAAAGG - Intergenic
1051032607 9:12700246-12700268 CTCCAGTAAAAGATGACGAATGG - Intronic
1051292138 9:15555326-15555348 TAGCAGTAATAGATAAAGAAAGG - Intronic
1052597796 9:30582827-30582849 GTGCTGTTATATATGAAGTAAGG + Intergenic
1053613233 9:39736604-39736626 CTTGAATTATAGATGAACAAGGG - Intergenic
1053871277 9:42494547-42494569 CTTGAATTATAGATGAACAAGGG - Intergenic
1054240282 9:62605798-62605820 CTTGAATTATAGATGAACAAGGG + Intergenic
1054361385 9:64123924-64123946 CTGCATTTAGAAATGAAGTAGGG + Intergenic
1054554415 9:66640324-66640346 CTTGAATTATAGATGAACAAGGG + Intergenic
1054944611 9:70782932-70782954 CTGCTGTCAAAGATGAGGAAGGG + Intronic
1055040371 9:71864518-71864540 GTGCAGTTAAATATGAAGACTGG - Intronic
1055870696 9:80875896-80875918 CTAAAGCAATAGATGAAGAAAGG + Intergenic
1056303491 9:85267104-85267126 ATGCAGTCATAGAGGGAGAAGGG - Intergenic
1056491142 9:87108284-87108306 GTACAGTTATAGGTGAAGAAAGG + Intergenic
1057060252 9:91997696-91997718 GTGCATTTAGATATGAAGAATGG - Intergenic
1057082677 9:92184907-92184929 CTGCAGTGAAATATGAAGAATGG + Intergenic
1059009004 9:110436222-110436244 CTGTGGTTATAGATGAAGTTAGG - Intronic
1059676566 9:116546046-116546068 CTGCAGTTATAGGAGAAGACAGG + Intronic
1061648267 9:132024315-132024337 CTCCTTTTACAGATGAAGAATGG + Intronic
1203606025 Un_KI270748v1:58211-58233 CTGGAGTTAGAGATAATGAAAGG + Intergenic
1185933727 X:4232239-4232261 CTGTACATAAAGATGAAGAATGG - Intergenic
1187018801 X:15358177-15358199 CTGCAGTTATAGATGAAGAATGG - Exonic
1188346441 X:29072339-29072361 CTTCACTCATAAATGAAGAAAGG + Intronic
1190738017 X:53268465-53268487 CTGTTTTTATAGATGAGGAATGG - Intronic
1190900967 X:54672739-54672761 CTGAAGTTGTAGATGCAGATGGG + Intergenic
1192860873 X:75069137-75069159 CTGAAATTGGAGATGAAGAAAGG + Intronic
1194763115 X:97817280-97817302 CTGCAGCTCTAAATGAAGACAGG - Intergenic
1196308413 X:114131615-114131637 ATGAAGTTATAGATGAGGATAGG - Intergenic
1196646941 X:118128109-118128131 CAGGCATTATAGATGAAGAACGG + Intergenic
1197464603 X:126787091-126787113 TTGCAGTTATCTATGAATAAAGG + Intergenic
1197711217 X:129670287-129670309 CTGAAGTTATATTTGTAGAAAGG + Intergenic
1200853566 Y:7911519-7911541 CTGCCATTATAGATGAAGTTTGG + Intergenic
1202094015 Y:21225947-21225969 ATGCATTTATATATGAATAAAGG - Intergenic