ID: 1187020234

View in Genome Browser
Species Human (GRCh38)
Location X:15373864-15373886
Sequence GCTACTTGGACCCCAAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187020234_1187020236 -2 Left 1187020234 X:15373864-15373886 CCTGGTTTTGGGGTCCAAGTAGC 0: 1
1: 0
2: 2
3: 2
4: 91
Right 1187020236 X:15373885-15373907 GCAATGTCTCACTCCACTCCCGG 0: 1
1: 0
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187020234 Original CRISPR GCTACTTGGACCCCAAAACC AGG (reversed) Intronic
900928257 1:5719522-5719544 GCTTCATGGTCCCCAAAGCCTGG + Intergenic
901174062 1:7285746-7285768 CCTACTTTCACCCCAAAAGCAGG - Intronic
905996340 1:42384120-42384142 GCTAGTGGGAGCCCAAATCCAGG + Intronic
907457834 1:54586830-54586852 GCTCCTTGGATCCCAGAAGCAGG - Intronic
908379582 1:63583535-63583557 TCTACTTGCTCCCCAAAACAAGG + Intronic
913278650 1:117164033-117164055 GCTGCTTGAACCCCAACAGCTGG + Intronic
916062686 1:161111217-161111239 GCTACTTGGATCCCAGTACTTGG - Intronic
921596127 1:217055547-217055569 CCTTCATGTACCCCAAAACCAGG + Intronic
924237114 1:242008391-242008413 GCCACTTGTACCCCATGACCAGG - Intergenic
924775803 1:247113898-247113920 GATGCAGGGACCCCAAAACCTGG - Intergenic
1063149065 10:3320528-3320550 GCTCCTTGGACCCCACAGTCTGG - Intergenic
1073360726 10:102896429-102896451 GAATCCTGGACCCCAAAACCTGG + Intronic
1081808026 11:45900593-45900615 GCTCCTCGGATCCCAACACCGGG - Intronic
1087495068 11:98880830-98880852 GCCACTTGGTCCCCACCACCAGG + Intergenic
1090652285 11:128817667-128817689 GCTATTTAGAACCCAATACCTGG + Intergenic
1091237737 11:134033157-134033179 GCTCCTCTGACCCAAAAACCAGG - Intergenic
1094498287 12:31002769-31002791 GCTCTTTGGCCACCAAAACCTGG + Intergenic
1095549827 12:43421246-43421268 GCTACTTGAACCCTAAATTCTGG - Intronic
1096122540 12:49097577-49097599 GCTACTTGGACCTCAGGACCTGG - Exonic
1096123451 12:49103369-49103391 GCTATTTGGCCCCCATCACCAGG + Intronic
1099121616 12:78696505-78696527 GCTAGTTGGACTCCACAAGCCGG + Intergenic
1113670144 13:112170726-112170748 GCTGCTGGGACCCCAAGCCCAGG - Intergenic
1115854055 14:37611072-37611094 CGGACTTGGACCCCAAACCCAGG - Intronic
1119133383 14:72194847-72194869 ACTACTTAGGGCCCAAAACCTGG - Intronic
1121778083 14:96603937-96603959 TCTAGTTGGACCTCAAAAACAGG - Intergenic
1122206636 14:100150940-100150962 GCCACTGGGACCCCAGAAACAGG + Intronic
1126049011 15:44670024-44670046 GCTACTTGGACGAAGAAACCGGG - Exonic
1130318461 15:82817596-82817618 GATAGTTTGACCACAAAACCAGG - Intronic
1130694751 15:86119768-86119790 GCTACTAGGACCCCACAACCAGG - Intergenic
1136102087 16:28003836-28003858 GCAACATGGACCCCAGAAGCAGG + Intronic
1138022497 16:53497281-53497303 GCTTCTTGCACTCCACAACCAGG + Intronic
1138411360 16:56842943-56842965 GCTTCTTGGCTGCCAAAACCAGG - Intronic
1139775886 16:69316880-69316902 GGAACTTGGACCCCCAAAGCAGG + Intronic
1141786997 16:86207703-86207725 GCTGCTTGGCCCCTAGAACCCGG + Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1148492258 17:48030891-48030913 GCTTCTGGCTCCCCAAAACCTGG + Intronic
1151358365 17:73573495-73573517 GCTGCTAGGACCCCAAACCTTGG + Intronic
1151882781 17:76905012-76905034 GCTCATTAGCCCCCAAAACCAGG - Intronic
1156977597 18:43243072-43243094 GCTACTTGGAGCCCAAAGTATGG + Intergenic
1159530790 18:69652738-69652760 GCTGCTTGAACCCTAAAAGCTGG - Intronic
1160000632 18:75017698-75017720 GTTACTTGGACCACAACACATGG - Intronic
927156169 2:20223047-20223069 GCTTCTTGGACCTGAAAGCCAGG + Intronic
937318874 2:120948826-120948848 GCTACTGTGACCTCAAACCCTGG + Intronic
938589143 2:132720486-132720508 GCAAGTGGGCCCCCAAAACCAGG + Intronic
939616588 2:144368217-144368239 GATACTTAGACCCCAAAACAGGG + Intergenic
941451324 2:165664264-165664286 CCAACTTGTACCACAAAACCAGG + Intronic
944346836 2:198677412-198677434 GCTACTTGAAGTCCAAAACTAGG + Intergenic
945967475 2:216204119-216204141 ACTACTTGAACCTCAAAACTGGG + Intronic
947912542 2:233810950-233810972 GGGAGTTAGACCCCAAAACCAGG - Intronic
1170004118 20:11646934-11646956 GCTTGTTGGACCCCAAACTCTGG - Intergenic
1170073576 20:12395188-12395210 GCTACCTGGTCCCCAACCCCAGG - Intergenic
1172057897 20:32166784-32166806 GCTACTTGAACCCTAATCCCTGG - Exonic
1173163969 20:40673258-40673280 GCAACATGGACACCAAAAGCTGG + Intergenic
1181582038 22:23833935-23833957 ACTCCAGGGACCCCAAAACCTGG - Intronic
1182689618 22:32149527-32149549 GCTACTTGGAACACTAAAGCCGG + Exonic
1183970548 22:41474217-41474239 GTTACTAAGACCCCAAACCCAGG - Intronic
954577729 3:51686028-51686050 GCTACCTTCCCCCCAAAACCAGG - Intronic
955421453 3:58742481-58742503 GTTACTTTGACCCCCAAACAGGG - Exonic
957972280 3:87397727-87397749 GCAGTTTGGACCCCCAAACCTGG - Intergenic
966214797 3:177491116-177491138 GGTCCTTGAACCCCAAAGCCAGG - Intergenic
978610517 4:110533558-110533580 GCTTCCTGAACCCCCAAACCTGG - Intronic
992050651 5:72937531-72937553 GCTACTTGTACCTCAACACTTGG - Intergenic
992110211 5:73485695-73485717 GCAACTTGGGCCCTACAACCTGG + Intergenic
1001208042 5:169782302-169782324 CCTGCTTGTACCCCAAACCCAGG - Intronic
1008639060 6:53443023-53443045 GCTCCTTTGACACAAAAACCTGG - Intergenic
1008975908 6:57426627-57426649 ACAACTTGGTCCCCAACACCTGG - Intronic
1009164435 6:60323750-60323772 ACAACTTGGTCCCCAACACCTGG - Intergenic
1023860620 7:44215966-44215988 GTTACTTGGACCCAAAATGCAGG + Intergenic
1026904144 7:74053237-74053259 GCTCCTGGGACACCAACACCTGG - Exonic
1027561137 7:79731947-79731969 TTTTCTTGGACCCTAAAACCAGG + Intergenic
1028473766 7:91232117-91232139 GATACTTGTACCTCCAAACCAGG + Intergenic
1029356044 7:100052485-100052507 TTTACTTGGACCGAAAAACCTGG - Intronic
1037418798 8:18679686-18679708 GCTACTTAGAAAGCAAAACCAGG + Intronic
1038742863 8:30231069-30231091 GCTACCTGGACCCCAACCCATGG - Intergenic
1043651741 8:82603271-82603293 GCTACTTGGGCCGCTAAAGCAGG + Intergenic
1046250906 8:111629832-111629854 GCAACATGTGCCCCAAAACCTGG + Intergenic
1046434709 8:114172466-114172488 ATTACTTTGACACCAAAACCAGG + Intergenic
1047823207 8:128544080-128544102 GCTACCTGGATCCCAAGGCCAGG + Intergenic
1048671560 8:136728964-136728986 GCTTCTTGGGCTCCAAAACTGGG + Intergenic
1048755929 8:137738127-137738149 GCTACTGGGATCCCCACACCTGG - Intergenic
1049470334 8:142772451-142772473 GTTCCTTGGACCCCCAAGCCTGG - Intronic
1051188109 9:14481828-14481850 GCTTTTTGGTCCCCAACACCAGG + Intergenic
1052253191 9:26424037-26424059 ACTACATGGAGCCCAAAACAAGG + Intergenic
1052436396 9:28435695-28435717 GCTACTTGATACACAAAACCAGG - Intronic
1056479461 9:86986340-86986362 GCTACATGGACCCAAAATCTAGG - Intergenic
1057665013 9:97038598-97038620 GCTACTCGCTCCCCTAAACCGGG + Intronic
1187020234 X:15373864-15373886 GCTACTTGGACCCCAAAACCAGG - Intronic
1189904051 X:45739419-45739441 AATACTTGGACACCAAAACAAGG + Intergenic
1196645714 X:118116241-118116263 TCTTCTAGGACCCCAGAACCCGG - Intronic
1197893560 X:131288540-131288562 GCCACTTGGACCCCTAAACCAGG + Intronic
1200823901 Y:7619452-7619474 CCTACTTGGACCCTAACTCCTGG - Intergenic
1201860875 Y:18596151-18596173 GCTTCTTGCCCCCCACAACCTGG + Intergenic
1201872448 Y:18724229-18724251 GCTTCTTGCCCCCCACAACCTGG - Intergenic
1202236154 Y:22711636-22711658 CCTACTTGGACCCTAACTCCTGG + Intergenic
1202307009 Y:23484532-23484554 CCTACTTGGACCCTAACTCCTGG - Intergenic
1202563796 Y:26186054-26186076 CCTACTTGGACCCTAACTCCTGG + Intergenic