ID: 1187023492

View in Genome Browser
Species Human (GRCh38)
Location X:15408682-15408704
Sequence CCTTTTCCACTGAAGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187023492_1187023497 0 Left 1187023492 X:15408682-15408704 CCATGTGCCTTCAGTGGAAAAGG 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1187023497 X:15408705-15408727 AGATCTGGAAAGAGAATGCAGGG 0: 1
1: 0
2: 3
3: 29
4: 402
1187023492_1187023499 20 Left 1187023492 X:15408682-15408704 CCATGTGCCTTCAGTGGAAAAGG 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1187023499 X:15408725-15408747 GGGCACAGTTCAATGCTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 130
1187023492_1187023496 -1 Left 1187023492 X:15408682-15408704 CCATGTGCCTTCAGTGGAAAAGG 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1187023496 X:15408704-15408726 GAGATCTGGAAAGAGAATGCAGG 0: 1
1: 0
2: 1
3: 33
4: 341
1187023492_1187023498 16 Left 1187023492 X:15408682-15408704 CCATGTGCCTTCAGTGGAAAAGG 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1187023498 X:15408721-15408743 TGCAGGGCACAGTTCAATGCTGG 0: 1
1: 0
2: 1
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187023492 Original CRISPR CCTTTTCCACTGAAGGCACA TGG (reversed) Intronic
900254944 1:1693132-1693154 GCCGTTCCACTGAAGGCAGAAGG + Intronic
900263693 1:1746411-1746433 GCCGTTCCACTGAAGGCAGAAGG + Intergenic
900421782 1:2558892-2558914 CCTCTTCCCCTGAGGTCACAGGG - Intronic
900467686 1:2833770-2833792 CCTTCCCCACTGGAGGCAGAGGG - Intergenic
901340575 1:8495155-8495177 CCTTTTCTTCTGAAGGAGCATGG - Exonic
904394265 1:30207737-30207759 CCCTCTCCACTCAAGGCAGATGG + Intergenic
905959270 1:42030060-42030082 ACTTTTCCCCAGAAAGCACAGGG - Intronic
907616273 1:55930033-55930055 CCTCTGCCACTGAAGGCAAAGGG + Intergenic
909467222 1:75985590-75985612 CCTTTTCCTCTGGAGCCACTTGG + Intergenic
910450977 1:87344857-87344879 ACTTGTCTACTGAAGACACATGG - Exonic
910786860 1:91008388-91008410 CCTTCTCCACTGACAGCAGAAGG + Intronic
912410061 1:109474946-109474968 CCTCTTCCCCAAAAGGCACATGG - Intronic
912574214 1:110650095-110650117 ACTTTTCCACTGAAGTGAGAAGG + Intergenic
912743947 1:112229078-112229100 CCTTTTCCATTGAAGTCAACTGG + Intergenic
913200440 1:116491806-116491828 GCTTTTCCAATAAAGGCACTAGG + Intergenic
914666874 1:149840023-149840045 ACTATTCCAGTGAAGGCACTCGG - Exonic
914668893 1:149853767-149853789 ACTATTCCAGTGAAGGCACTCGG + Exonic
915431805 1:155872509-155872531 TCTGTTCCACTGAAGGAGCAAGG + Intronic
915893147 1:159789907-159789929 CCTTTCCCAGTAAAGTCACATGG + Intergenic
917669733 1:177262099-177262121 CCTTTTGCTATGAAGGCAAATGG + Intronic
917994453 1:180420775-180420797 CCTTTTCCCTTCAAGGCACAGGG + Intronic
921440684 1:215182427-215182449 CCCTTTCCACTGAAACCCCAGGG - Intronic
921654995 1:217723939-217723961 CCCTGTCCTCTGAAGGGACATGG + Intronic
921680042 1:218020601-218020623 CCTCTGCCAGTGAAGGCAAAGGG - Intergenic
923434647 1:233956681-233956703 CCTTTTCCATGGAAGGCAACTGG + Intronic
923684589 1:236145071-236145093 GCTTTTCGCCTGAGGGCACAGGG + Intronic
924654730 1:245963591-245963613 CTTTTTCCACTGGAAGCATAAGG - Intronic
1065045227 10:21741639-21741661 ACTTTTCCACAGAAGTAACATGG - Intronic
1065980129 10:30886702-30886724 CAGTTTCTACTGAATGCACATGG + Intronic
1066823391 10:39526969-39526991 CCGTTTCCATTGAAGGCTCAAGG - Intergenic
1066981179 10:42418100-42418122 CCTATTTCACTCAAGGCCCAGGG + Intergenic
1068083513 10:52347397-52347419 CCCTTTCCCCTGCAGGCTCAAGG + Intergenic
1069964740 10:72105171-72105193 CCTCTGCCACTGAGGGCAAAGGG - Intronic
1072239565 10:93482988-93483010 CCATTTTCACTGAAGGCAATTGG - Intergenic
1072940780 10:99761667-99761689 TCTTTTCCTTTGAAGGCTCAGGG + Intergenic
1073154028 10:101332359-101332381 CATTATCCACTGAAGGCTAAAGG - Intergenic
1073660050 10:105464970-105464992 CCTGTACCACTGGGGGCACATGG + Intergenic
1074171566 10:110944319-110944341 CATTTTCCACTGTGGGCAGAAGG - Intronic
1075153720 10:119956957-119956979 CCTTTACCAGTGATGGCCCAGGG + Intergenic
1075950319 10:126471595-126471617 CCTTTTTCTCTGAATACACAGGG - Intronic
1076104693 10:127812152-127812174 CCCATTGCACTGAGGGCACAGGG - Intergenic
1081285276 11:41261209-41261231 CCTTTTCCACCGCAGCAACAAGG + Intronic
1081833885 11:46137466-46137488 CCTTTTCCACGCAAGGGAAAAGG + Intergenic
1082269870 11:50158684-50158706 TATAGTCCACTGAAGGCACAGGG + Intergenic
1083892177 11:65600977-65600999 CCACTGCCACTGAAGGGACAAGG + Intronic
1085558840 11:77451325-77451347 CATTTTTCTCTGAAGACACAGGG + Intronic
1088128606 11:106460190-106460212 CCTTTATCTCTGAAGACACAGGG + Intergenic
1089441136 11:118518254-118518276 CTTTTTCCATTAAAGGGACAGGG - Intronic
1090361089 11:126173195-126173217 CCCTTTCCCCTCAAGCCACACGG - Intergenic
1090578317 11:128132739-128132761 CATTTTCAAATGAGGGCACAGGG + Intergenic
1091509436 12:1107233-1107255 CCTTTACCAGTGGAGGAACAGGG + Intronic
1093860204 12:24156100-24156122 CCTCTTCCACTGTAGGAACATGG + Intergenic
1093888052 12:24486237-24486259 CATTATCTACTGAAGGCATAGGG - Intergenic
1095430923 12:42133883-42133905 CATTTTTCACTGAAGGGAAAAGG - Intronic
1097694930 12:62766738-62766760 TCTTCTCCAGTGGAGGCACATGG + Intronic
1097962801 12:65548943-65548965 CTTTTGTCACTGAAGGCAGAAGG - Intergenic
1098568897 12:71967227-71967249 CCTTCTTCTCTGCAGGCACAAGG + Intronic
1104232194 12:126896397-126896419 CCTCTTCCAGTGAAGCCATACGG - Intergenic
1104603719 12:130171671-130171693 ACTTTTCCACACATGGCACAGGG + Intergenic
1105061146 12:133152064-133152086 CCTTTGCCTCTGAATGCAAATGG - Intronic
1106812420 13:33372626-33372648 ACTATTCCACAGAAGGCACATGG + Intergenic
1106870262 13:34011653-34011675 CCTCTGCCAGTGAAGGCAAAGGG - Intergenic
1112944718 13:104914166-104914188 CCATTTCTTCTGAAGCCACATGG + Intergenic
1113782980 13:112987077-112987099 CCTTTTACACAGATGGCACCCGG + Intronic
1115887255 14:37986222-37986244 CCTTTTCCCCAGAGGGCAGAGGG + Intronic
1118145114 14:63126524-63126546 CCTTTCCCAGTGGAGTCACAGGG - Intergenic
1118325847 14:64779856-64779878 CCTCTCCCATTGAAGGCACCTGG + Exonic
1120765172 14:88322308-88322330 CCTTTCCCACTGAGGACACCCGG + Intronic
1121226912 14:92327817-92327839 CCCTTTCCACAAAAGGGACAAGG - Intronic
1122082164 14:99273661-99273683 CCTTTTCCTCGGGGGGCACACGG + Intergenic
1124898260 15:33797774-33797796 CTTTTCCCACTGAAGGCATCTGG + Intronic
1125507336 15:40274358-40274380 TCCCTTCCACTGAAGCCACAGGG + Intronic
1125760384 15:42092519-42092541 TCTTTTCCCCTGAGGGCATAGGG + Intronic
1126882948 15:53118839-53118861 CCTTTTCCACTGTCTGCTCATGG - Intergenic
1127019221 15:54727292-54727314 CAGTTTCCACTGCAGGCACCAGG - Intergenic
1127943455 15:63725358-63725380 CCTGTTCCTCTGGAGACACAGGG + Exonic
1128155692 15:65390247-65390269 CTTTTTCCACCGAAGCCAGATGG + Exonic
1129192415 15:73945230-73945252 CCTTTTCCATTCAGGGAACATGG - Intronic
1131753421 15:95534692-95534714 CCTTTTGGACTGAAGCCCCATGG - Intergenic
1135390263 16:22087079-22087101 CCTTTACTACTGAACTCACAGGG + Intronic
1137847095 16:51701254-51701276 CATTTTCCAGAAAAGGCACAGGG - Intergenic
1139046088 16:63061683-63061705 CCTTTGCCAGTGAGGGCAAAGGG + Intergenic
1140893724 16:79307092-79307114 CTTTTTCCACTCAAGAAACAGGG + Intergenic
1141208019 16:81948833-81948855 CTTTTTCCACTGCATGCTCATGG - Intronic
1141535993 16:84680091-84680113 CCTTGTGCACTGAAGTCACTAGG + Intergenic
1142239088 16:88936972-88936994 TCTTTTCCACTGATGCTACAAGG + Intronic
1143591191 17:7886478-7886500 CGTTTGCCACAGAAGCCACACGG - Intronic
1149220867 17:54414215-54414237 CCTTCCCCACTCAAGGCAAATGG + Intergenic
1150628497 17:66859089-66859111 CCTTTTCATCTGAAGTCACGGGG + Intronic
1151503096 17:74505057-74505079 CCCTCTCCACTCAAGGCAGATGG + Intergenic
1152326709 17:79645714-79645736 CCTCCTTCACTTAAGGCACAGGG + Intergenic
1152641103 17:81449605-81449627 CCCCTTCCACTGAAGGCCCCAGG - Intronic
1155028474 18:21963573-21963595 CCTTTTCACCTGATGACACACGG - Intergenic
1156911615 18:42417385-42417407 CCTTTGCCAGTGAGGGCAAAGGG + Intergenic
1157282895 18:46357853-46357875 CCGTCTCCTCTGAAGGCACCAGG + Intronic
1157367782 18:47081818-47081840 CATTTCCCACTAAAGGCACAAGG - Intronic
1158710625 18:59834565-59834587 ACATTTCCACTGCAGTCACATGG - Intergenic
1161435637 19:4261142-4261164 CCTTGGCCTCTAAAGGCACAGGG + Intronic
1161767569 19:6215910-6215932 CCTTTTCCCCAGGAGGCACAGGG - Intronic
1164712643 19:30368436-30368458 CCTTTGCAACTGAAGTCACACGG + Intronic
1167189785 19:47977087-47977109 CCTATTTCACCAAAGGCACATGG + Intronic
1168304982 19:55430299-55430321 CCGTTTCCACTAAAAGGACAGGG - Exonic
1168449825 19:56457661-56457683 CCTCTCCCACTGAAGGCTCCAGG - Intronic
926214213 2:10894102-10894124 CCTTTCCCTCTGAGGGCAAATGG - Intergenic
928102459 2:28447198-28447220 CCTTTTCCAAGGAAGTCACAGGG + Intergenic
928264904 2:29802728-29802750 CCCTTTCCAGTGTAGGTACAAGG - Intronic
928687911 2:33768316-33768338 GATTCTCCACTGAGGGCACAAGG + Intergenic
929205334 2:39285140-39285162 CCTTTTCCACTGAAAGCACTGGG + Intronic
931528416 2:63185469-63185491 TCTTTGCCACTGAATGCACCCGG - Intronic
931665770 2:64608989-64609011 CCTTGTCCACAGGAGACACAAGG - Intergenic
932908070 2:75775734-75775756 CCTTTGCAAATGAAGGCAAAGGG + Intergenic
933888187 2:86739820-86739842 CCTCTCCCAGTGAAGTCACATGG - Intronic
933921991 2:87056886-87056908 CCTCTCCCAGTGAAGTCACATGG + Intergenic
935223667 2:101035568-101035590 CCTCCTCCAGTGAAGACACATGG - Intronic
937079000 2:119126923-119126945 CCTGTTCCCCTGAAGGACCATGG - Intergenic
941855833 2:170229945-170229967 CCCTTTCTACTGTAAGCACAGGG - Intronic
945665942 2:212742477-212742499 ACATTTCTACTGAATGCACATGG + Intergenic
945691715 2:213044760-213044782 CCTTATCCACTTAAGCCTCAAGG + Intronic
945858503 2:215094457-215094479 CCCTTCCCACTCAAGGCAAATGG + Intronic
946673127 2:222127938-222127960 CCATTCCCACTAAAGGAACACGG + Intergenic
946836171 2:223774767-223774789 CCTTTTGCACTGAAGGATCCTGG + Intronic
1170680083 20:18518615-18518637 CCCTCTCCACTCAAGGCAGATGG - Intronic
1173050101 20:39550990-39551012 ACTTTTCCACTGATGGCACTGGG - Intergenic
1174719016 20:52791005-52791027 CCTTTACAACTGAAGGGGCAAGG + Intergenic
1175206291 20:57314182-57314204 AGTTTTCCACTGCAGTCACAGGG + Intergenic
1175584608 20:60127964-60127986 CCTTTGCCTTTGGAGGCACAAGG + Intergenic
1177267452 21:18803127-18803149 CTTTTTCCACTTAATGCACTGGG - Intergenic
1180588611 22:16915970-16915992 CCTTTTCAACTGCAGACTCATGG - Intergenic
1181171187 22:21011220-21011242 CCTCTTCCACTCCAGCCACACGG - Intronic
1181178158 22:21049299-21049321 CCTCTTCCACTCCAGCCACACGG + Intronic
1181516281 22:23415404-23415426 CCCTCCCCACTGAACGCACAAGG + Intergenic
1181859807 22:25809434-25809456 CCTTTTTCTCTGAAGGCCCATGG + Intronic
949090146 3:17728-17750 GACATTCCACTGAAGGCACAGGG + Intergenic
953361543 3:42301494-42301516 CCTTTTTCCATAAAGGCACAGGG + Intergenic
955531958 3:59882801-59882823 CCTTTGTCACTGAAGAAACATGG + Intronic
956274113 3:67479514-67479536 CCTTTTCCCCAGACAGCACAAGG + Intronic
957609687 3:82451018-82451040 CCTTTCCCAGTGAAGGAATATGG + Intergenic
957678999 3:83407016-83407038 GCTTTTCAACTGATGGCATAAGG - Intergenic
960960686 3:123068165-123068187 CCTTTTCCCCTGAAGTTCCAGGG + Intronic
961093927 3:124138744-124138766 CCTGGACCACTGAAGGGACATGG + Intronic
961786915 3:129352879-129352901 CCTTTGCCACTGAAGCCTCCCGG + Intergenic
964505684 3:157396239-157396261 CCTTTTCCTTTGCAGGAACATGG - Intronic
965375688 3:167921040-167921062 CCTCTTCCAAGGAAGGCACATGG - Intergenic
966072987 3:175902415-175902437 CCTCTTCCAGTAAAGTCACAGGG + Intergenic
966958406 3:184908621-184908643 CCTTTGCCAGCGAAGGCAAAAGG + Intronic
968427169 4:531812-531834 CCATGTCCACGCAAGGCACAAGG + Intronic
968781689 4:2587185-2587207 TTTTTTCCACTTACGGCACAAGG + Intronic
974526366 4:63054136-63054158 CCTATTCAACTGAGGGCAAAAGG + Intergenic
976085204 4:81400799-81400821 CCTTTGCCACTGCAGGCAAAGGG + Intergenic
976161977 4:82211287-82211309 CAGTTTCCACTGAATGCACAAGG - Intergenic
976956231 4:90903578-90903600 CTTCCTCCACTCAAGGCACATGG + Intronic
979640590 4:123009159-123009181 CCTTTTCCAGTGGAGTCACATGG + Intronic
979994620 4:127415734-127415756 CACTTTCTACTGAAGGCATATGG - Intergenic
983093921 4:163539964-163539986 TCCTCTCCCCTGAAGGCACAGGG + Intronic
983255684 4:165397536-165397558 CATCTTCCACTCAAGTCACATGG - Intronic
985610160 5:883415-883437 CTGTTTCCACTGAAGACACTGGG + Intronic
986243260 5:5980605-5980627 CCTCTTCCCCTGAAGCCAGAGGG - Intergenic
986496056 5:8343294-8343316 ACATTACCACTGAAGCCACAGGG + Intergenic
987246348 5:16053095-16053117 CCTTTTACTCAGAAGGCAGAAGG + Intergenic
987246497 5:16054363-16054385 CCTTTAACTCTGAAGGCAGAAGG - Intergenic
990689093 5:58342699-58342721 CCATTTCCAATGAAGGAACCAGG + Intergenic
990980104 5:61594645-61594667 CCTTTACCACTGACTTCACAGGG + Intergenic
991513926 5:67412973-67412995 CGGTTTCTACTGAAGGCATATGG + Intergenic
993840180 5:92868017-92868039 ACTTTTCCACTGTAGGGACAAGG + Intergenic
997294564 5:132761618-132761640 CATTCTCCACTGAAAGCAGAGGG + Exonic
997603256 5:135154933-135154955 GCTTTTCCACTGAAGGGAACAGG - Intronic
998100850 5:139432782-139432804 TCTTTTCCATTCAAGGCTCAGGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1000438079 5:161237955-161237977 ACTCTTCCAAGGAAGGCACAGGG - Intergenic
1002643538 5:180641692-180641714 CCTTAAGCTCTGAAGGCACAGGG - Intronic
1002900484 6:1406362-1406384 CCCTTTCCACTGAGGTCCCATGG + Intergenic
1004866247 6:19855957-19855979 CCTTTTCAATTGAAGCCACAAGG + Intergenic
1005708236 6:28478544-28478566 CATTTTCCACTGCGAGCACAAGG - Intergenic
1006042593 6:31268572-31268594 AAGTTTCCACTGAAGGGACAAGG + Intergenic
1006052184 6:31353694-31353716 AAGTTTCCACTGAAGGGACAAGG + Intronic
1006572821 6:35019402-35019424 CCATTTCCAGTGAAGGAACTGGG + Intronic
1007732687 6:43958438-43958460 CCTTTTCCCCTTGAGGCTCAAGG - Intergenic
1008995142 6:57650459-57650481 AGTTTTGCACTGAAAGCACAGGG + Intergenic
1009183678 6:60549216-60549238 AGTTTTGCACTGAAAGCACAGGG + Intergenic
1009261968 6:61502836-61502858 TCTTTTTCACTGTAGGCTCAAGG + Intergenic
1011912434 6:92457882-92457904 CCTTTTACCCTACAGGCACAAGG + Intergenic
1014791193 6:125674336-125674358 CCTCTCACACTGAAAGCACAGGG + Intergenic
1016796590 6:148124568-148124590 CCTTGTCCAGTGAATCCACATGG + Intergenic
1018614782 6:165676618-165676640 CCTAGTCCACTCCAGGCACATGG - Intronic
1019686045 7:2382822-2382844 CCTTTTCCACTGCAAGCCCGGGG - Intergenic
1020794548 7:12664157-12664179 CCCTCTCCACTCAAGGCAGATGG + Intergenic
1022952174 7:35349529-35349551 TATTTTCCAGTGAGGGCACATGG + Intergenic
1023357461 7:39381568-39381590 CTTTTTCCACCCCAGGCACAAGG + Intronic
1024613587 7:51088061-51088083 GCTTTTCCTCTGCAGGCTCAGGG + Intronic
1024859154 7:53817583-53817605 TCTTTTCCATTGAAGGCTCTGGG - Intergenic
1029510252 7:100990069-100990091 TATATTCCACAGAAGGCACAAGG + Intronic
1031126624 7:117781038-117781060 CCTTTTATAGAGAAGGCACATGG - Intronic
1031198793 7:118650771-118650793 CCCTTTCCACAGAGGCCACAGGG - Intergenic
1033625878 7:143109150-143109172 CCCTCTCCACTCAAGGCAGATGG + Intergenic
1034693275 7:153031241-153031263 CCTTTTCCAATGCATACACATGG + Intergenic
1036946683 8:13100724-13100746 CATTTGCCACTGATGGCACAAGG + Exonic
1038291053 8:26250329-26250351 GCTTTTCCAGTGAAGGCATCTGG + Intergenic
1039380068 8:37076666-37076688 CCTCTTCCACTGAATCCCCAGGG + Intergenic
1041165746 8:55090739-55090761 CCCTGTCCAAAGAAGGCACATGG + Intergenic
1043596042 8:81885980-81886002 CCTTTGCCACTGGCTGCACAAGG - Intergenic
1043700094 8:83275969-83275991 CCTTTTCACCTGAAGGCAGCAGG + Intergenic
1043702296 8:83304373-83304395 CTTTTTCCACTTAATTCACAGGG + Intergenic
1044477462 8:92645317-92645339 CCCTTTCCTCTGTATGCACATGG + Intergenic
1044779115 8:95724879-95724901 CCTTTTCCACTGAACCAAGAGGG - Intergenic
1045402880 8:101836061-101836083 CATTTCCCACTGAAGGGACGGGG + Intronic
1045900293 8:107270565-107270587 CCCTTTCCACTGAAAGAACTGGG + Intronic
1048768451 8:137869054-137869076 CTTTTTCCACTGTAACCACATGG - Intergenic
1049844379 8:144792910-144792932 CCTTATCCACTGTAGGCCCTTGG + Intergenic
1051589070 9:18757671-18757693 CCTTCTACACTGAAGCCACATGG + Intronic
1052192146 9:25673410-25673432 TCTTTTCCACACAAGGCAAATGG + Intergenic
1053456492 9:38236937-38236959 CATTTTCCACTGAAGGACAAAGG - Intergenic
1054779395 9:69152752-69152774 CATTTTCCACTGAATTAACAGGG + Intronic
1055012047 9:71577778-71577800 CCTTTGACACTGAAGGCACTGGG - Intergenic
1056246741 9:84702984-84703006 CTTTGTCCACTGAAGTCAAACGG + Intronic
1056293483 9:85167813-85167835 GCTTTTCTACTGAATGCTCATGG + Intergenic
1057135531 9:92685074-92685096 ATTTTCCCACTGAAGGCAAATGG + Intergenic
1060920235 9:127415239-127415261 CCCTCCCCACTGAAGGCAAATGG - Intergenic
1061247094 9:129406126-129406148 CCTTTTCTACTGAAAGCATCAGG - Intergenic
1061889783 9:133612428-133612450 CATTTTCCACTTAGGGCAAATGG + Intergenic
1186664116 X:11701210-11701232 ACTTTTCCATTCATGGCACAGGG - Intergenic
1187023492 X:15408682-15408704 CCTTTTCCACTGAAGGCACATGG - Intronic
1187103447 X:16218201-16218223 CCCTCTCCACTCAAGGCAGATGG - Intergenic
1187124109 X:16437523-16437545 GCCTTTCCTCTGAGGGCACAAGG + Intergenic
1187393442 X:18900984-18901006 CCTTTTGAACTGACCGCACAGGG - Intronic
1188206361 X:27363850-27363872 CCTTCTCCACAGAATCCACAGGG + Intergenic
1188262180 X:28034777-28034799 TCTTTTCCACAGCAGGCACCAGG + Intergenic
1191013879 X:55789712-55789734 CCCTCTCCACTCAAGGCAGATGG - Intergenic
1193337676 X:80309483-80309505 CCTTTCCCAGTGAAGTCACATGG - Intergenic
1194451812 X:94052737-94052759 TCTATTCCACTGAAAGCAGAAGG + Intergenic
1195635399 X:107108622-107108644 TCTTTTCAACTAAAGGCACCAGG + Intronic
1197997511 X:132394126-132394148 CCCTTTCCACTTAAGGCTCTTGG - Intronic
1198217159 X:134566168-134566190 TCTTCTTCACTGAAGACACAAGG + Exonic
1201532481 Y:15007237-15007259 CCTTTTCCATTTAAGCCAGAGGG - Intergenic