ID: 1187027294

View in Genome Browser
Species Human (GRCh38)
Location X:15448790-15448812
Sequence CTGCTTGTGTGGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187027294_1187027297 -2 Left 1187027294 X:15448790-15448812 CCTTGCTCCATCCACACAAGCAG 0: 1
1: 0
2: 4
3: 27
4: 307
Right 1187027297 X:15448811-15448833 AGAATTGATTCTCCCTATTCTGG 0: 1
1: 0
2: 0
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187027294 Original CRISPR CTGCTTGTGTGGATGGAGCA AGG (reversed) Intronic
900607628 1:3530958-3530980 CTGCTAGGCTGGAGGGAGCAGGG - Intronic
900895348 1:5479362-5479384 CTGCCTGTGGGGATGCAGGAAGG + Intergenic
900952507 1:5865845-5865867 GTGCTTCTGAGGATGGGGCAGGG - Intronic
901199605 1:7459141-7459163 CTGCTGGGGAGGAAGGAGCAAGG + Intronic
902108848 1:14060970-14060992 CTGCTGGTGTGGGAGGAGAAGGG - Intergenic
902113749 1:14104233-14104255 CTCCTTGCGGGGAAGGAGCAGGG - Intergenic
902755388 1:18545995-18546017 CTCCTAGTGTGGTTTGAGCATGG - Intergenic
903701498 1:25251999-25252021 CTGCTTGGGAGGCTGGGGCATGG - Intronic
904290341 1:29481259-29481281 GTGCTGGTGTGGGTGGGGCATGG + Intergenic
904412302 1:30331804-30331826 GTGCCTGTGTGCATGGGGCAAGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904832912 1:33316726-33316748 CTGGTTGTCTGGTTGGAGGAAGG + Intronic
905497481 1:38403950-38403972 CTGCTTTTGTGGAGGTAGCAGGG - Intergenic
906783450 1:48593207-48593229 CCACTTGTGTGTTTGGAGCAGGG - Intronic
907391458 1:54160946-54160968 ATGGTTTTGTGGAAGGAGCAAGG + Intronic
907634084 1:56115808-56115830 CTCCTTGTTTGTATGGAGGAGGG + Intergenic
908382877 1:63613090-63613112 TTGTTTGTGTATATGGAGCATGG + Intronic
909984214 1:82140698-82140720 CTGCTAAGGTGGAAGGAGCAGGG + Intergenic
910907903 1:92201019-92201041 CTGCTTGTGAGGCTGAGGCAGGG - Intergenic
911704606 1:100997002-100997024 CTGCTTTTGTTAATGGAGCAAGG + Intronic
912265493 1:108152953-108152975 CTGTCTGTGTTGCTGGAGCAGGG + Intronic
912612392 1:111061765-111061787 CTGCTTCAGTGGAGGAAGCAGGG + Intergenic
913508954 1:119545271-119545293 ATGCTGGTGTGGATGAAGCCTGG - Intergenic
917837345 1:178951966-178951988 CTGCATGTGAGCGTGGAGCAGGG + Intergenic
918828398 1:189357472-189357494 CAGCCTGTGTTGCTGGAGCATGG + Intergenic
919604965 1:199670273-199670295 AAGCTTGAGTGGATGGAGAAGGG + Intergenic
919850451 1:201668645-201668667 CTGCTTGGAAGGTTGGAGCATGG + Intronic
919976224 1:202614813-202614835 CAGCTGGAGTGGATGGATCACGG + Intronic
921200097 1:212796394-212796416 CTGATTGTATTGATGAAGCATGG + Intronic
922503129 1:226110898-226110920 CCGGCTGTGTGGCTGGAGCAAGG - Intergenic
923195698 1:231664593-231664615 CTGCTTTTGAAGATGGAGAAAGG + Intronic
924603906 1:245515876-245515898 CTGCCTGTGAGGGTGGAGAAGGG + Intronic
924768035 1:247052473-247052495 CTGCTTCATTGGATGTAGCAGGG + Intronic
1063473379 10:6307122-6307144 CTGATGCTGTGGATGGAGCCTGG - Intergenic
1064091045 10:12385145-12385167 CTGCTGGTGTGGATGTAAAATGG + Intronic
1064461516 10:15539321-15539343 CTGGTTGTGTCCAAGGAGCATGG + Intronic
1065722073 10:28636704-28636726 TTGCAAGTGTGCATGGAGCAGGG + Intergenic
1067004963 10:42651903-42651925 CTTCTGGTGTGGTCGGAGCAGGG - Intergenic
1067148173 10:43708736-43708758 CTGATTCTGTGGAGAGAGCATGG - Intergenic
1067454250 10:46404938-46404960 CTGCCTTTGAGGATGGAGGAAGG - Intergenic
1067632953 10:47979694-47979716 CTGCCTTTGAGGATGGAGGAAGG + Intergenic
1069004593 10:63303414-63303436 CTACTTGTGAGGCTGAAGCAGGG - Intronic
1070480739 10:76880350-76880372 CTCCTTGTGTTGAGGCAGCATGG - Intronic
1070688261 10:78505941-78505963 CTGCTTGTGGGGATGTAGAATGG + Intergenic
1070975460 10:80602866-80602888 CTGCTTGAGTGGTGGGACCACGG + Intronic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1071669247 10:87591999-87592021 TTGCTTGTGAGGTTGTAGCATGG + Intergenic
1073929961 10:108564273-108564295 CTGCTTGGGGGGCTGAAGCAGGG + Intergenic
1074012863 10:109501563-109501585 CTGGTTCCGTGGCTGGAGCAGGG + Intergenic
1074120246 10:110488618-110488640 TTGGTGGTGGGGATGGAGCAGGG + Intergenic
1074910968 10:117908486-117908508 CTGCTTATGGGGAGGGAGGAAGG - Intergenic
1075446280 10:122515724-122515746 ATGCCTCTGTGGATGGAGGAAGG - Intergenic
1076538106 10:131195856-131195878 CGCCTTGTGTGGATGGAGCCAGG - Intronic
1076826359 10:132971631-132971653 CCTCTTGTGGGGAAGGAGCAGGG + Intergenic
1077308351 11:1877749-1877771 ATGCCTGTGTGGCTGGAGCGTGG + Intronic
1077728561 11:4703198-4703220 CTGGTTGTCTGGTTGGACCAAGG + Intergenic
1078901656 11:15648269-15648291 AGGCCTGTGTGGATGAAGCAGGG - Intergenic
1081722209 11:45298643-45298665 CTGCTGGTGTGGATGGGCCATGG + Intergenic
1082947483 11:58775152-58775174 CCTCTGGTGTGGTTGGAGCAGGG - Intergenic
1083818070 11:65148827-65148849 CTGCTGGTGTGGTTCCAGCAGGG - Intergenic
1084270157 11:68024986-68025008 CTGCTTCTGGAGTTGGAGCAGGG - Intronic
1084373194 11:68758425-68758447 CTTCCTCTGTGGATGGAACAAGG - Intronic
1084553162 11:69861035-69861057 CTGCTTATCTGGATGAAGCTCGG - Intergenic
1085632314 11:78128719-78128741 CTACTTGGGTGGCTGGGGCAGGG - Intronic
1087063813 11:94009347-94009369 CTGGTTGTGAGGTTTGAGCACGG + Intergenic
1089631323 11:119786412-119786434 GTGATGGTGTGGATGGAGAAAGG + Intergenic
1090005520 11:122998943-122998965 CTGCTGTTGTGGTGGGAGCAGGG - Intergenic
1090725367 11:129520943-129520965 TTGCTGGTGTGGATGCAGGATGG + Intergenic
1092945767 12:13452731-13452753 CTGACTATGTGGATGGAGTATGG + Intergenic
1093006857 12:14060667-14060689 GTGCTAGTGTAGATGGAGAAAGG + Intergenic
1094805971 12:34092670-34092692 CTCCTTTAGTGGATGGAGCCAGG + Intergenic
1095124659 12:38462650-38462672 CTCCTTTAGTGGATGGAGCCAGG + Intergenic
1095367975 12:41430868-41430890 CTGCTTCTGTGGAGGCTGCAGGG + Intronic
1095606257 12:44071240-44071262 CTGCCTGAGTGGATGCAGCTGGG + Intronic
1097603939 12:61730110-61730132 CTGCTGTGGTGGATGTAGCAAGG + Intronic
1098215063 12:68207138-68207160 CTGCTGGTGTAGCTGTAGCAGGG + Intronic
1099415149 12:82375324-82375346 CTGCATGTGAAGATGTAGCAAGG + Intronic
1100021390 12:90073641-90073663 AGGCTTGTGTGGCTGGAGAAAGG + Intergenic
1100951324 12:99853338-99853360 CTGCTCTTGTGGGTGTAGCAGGG - Intronic
1102503525 12:113369242-113369264 ATGCTTGTGGGGCTGGGGCAGGG - Intronic
1103550285 12:121732200-121732222 CTGCTTGTGAGGCTGGCACAAGG + Intronic
1103705080 12:122867134-122867156 CGGCTGGTGTGGAGGGAGCCGGG + Exonic
1103885027 12:124193971-124193993 GTGCGTGTGTGGAAGGAGCTGGG + Intronic
1104642834 12:130478386-130478408 CGCCTGGTGTGGATGGACCATGG + Intronic
1106249622 13:27973568-27973590 CTGCTTCTGTGAATGAAGCCTGG - Intergenic
1106470229 13:30047663-30047685 CTGCTTGTAAGGCTGGATCACGG + Intergenic
1106526786 13:30547804-30547826 CTGCTTGGGAGGCTGAAGCAGGG + Intronic
1110499696 13:76212868-76212890 CTGTTTTTGTGGATGAAGAATGG - Intergenic
1110846262 13:80193693-80193715 CTGCGTCTGTGGATGAACCATGG + Intergenic
1114812985 14:25922521-25922543 CTGCTGGTGTGAATGTAGAATGG - Intergenic
1116854925 14:49943850-49943872 CTGCTTCTGTGGATGCTGGATGG - Intergenic
1118573973 14:67223108-67223130 CTACTTGGGAGGCTGGAGCAGGG - Intronic
1118918937 14:70132486-70132508 CTGCTTCTGTGGCTGGAGGTCGG - Intronic
1121269330 14:92627467-92627489 CTGCTTGTGTGAATGGTGATAGG - Intronic
1121458130 14:94052199-94052221 TTGGTGGTGTGGAAGGAGCATGG + Intronic
1121736502 14:96221649-96221671 GTGCTTGAGTGGTTGGTGCAAGG + Intronic
1122917749 14:104866514-104866536 CTGCCTGTCTGGCTGGAGCTGGG + Intronic
1124491872 15:30163160-30163182 CAGCTGGAGTGGATGGAGCATGG + Intergenic
1124689313 15:31808692-31808714 GTGCTGCTGTGGATGGAGCCTGG - Intronic
1124751664 15:32375157-32375179 CAGCTGGAGTGGATGGAGCATGG - Intergenic
1125760656 15:42093685-42093707 CTGCTTGTCTGGATCCAGCTTGG + Intronic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1127012281 15:54643678-54643700 CTGCTGCTGGGGATGGAGAAGGG - Intergenic
1127142939 15:55994942-55994964 CTGCTTGGGTGGCTGAGGCAAGG + Intergenic
1128529636 15:68435546-68435568 CTGCAGGTGTGGCTGGATCAAGG + Intergenic
1130222696 15:82033926-82033948 CTGCCTGTGTGTATGGGGTAGGG - Intergenic
1131118882 15:89810890-89810912 CAGCTTGTGTGTAGGGAGGAAGG - Intronic
1132081587 15:98870562-98870584 CAGCCAGTGTGGTTGGAGCAGGG + Intronic
1132253732 15:100355557-100355579 CTGCTCCGGTGGAGGGAGCAGGG - Intergenic
1132542802 16:519184-519206 CTGCTCCTGTGGGTGGAGCACGG - Intronic
1132860140 16:2066607-2066629 CTGCTCGAGTGGATGGAAAATGG - Intronic
1133337941 16:5018374-5018396 CTGCTTGTGTGGGCGGGGCGTGG + Exonic
1134143800 16:11743755-11743777 CTGCTTCTGTGGATGTAGAATGG + Intergenic
1134446127 16:14332877-14332899 CTGCTTGGGGAGATGGTGCAGGG + Intergenic
1135109818 16:19681853-19681875 CTGCTTTTGTGGTTGGAACAGGG + Intronic
1136014464 16:27386566-27386588 CTGAGTGTGTGGTTGGACCAAGG - Intergenic
1136618988 16:31415516-31415538 CTGGGTGTGTGGATGGAGGTGGG - Intronic
1137396162 16:48117410-48117432 CTGCTGGTGTTGCTGGGGCAAGG + Intronic
1138301082 16:55930321-55930343 AGGCTGGTGTGGCTGGAGCAGGG - Intronic
1139285935 16:65814070-65814092 CAGGTTGTCTGAATGGAGCATGG + Intergenic
1140197448 16:72866830-72866852 GTGCCTGTGTGGATGGTGAATGG - Intronic
1141214667 16:82011834-82011856 TTGCTTGGGTGGATGGATGATGG + Intergenic
1141927595 16:87179338-87179360 CTGTTTGTGGGGGTGGGGCAGGG - Intronic
1142104799 16:88296724-88296746 ATGTGTGTGTGGGTGGAGCATGG - Intergenic
1142974473 17:3635560-3635582 CTGCTTCTGTGGAATGAGCCAGG + Intronic
1143482075 17:7233553-7233575 CTACTTGGGTGGCTGAAGCAGGG - Intronic
1143564228 17:7711924-7711946 CTGCTTTTGTGGTTGGAGAATGG - Intergenic
1143757300 17:9076254-9076276 AGGCTGGTGTGGATGGAGGATGG - Intronic
1144130669 17:12243571-12243593 CTGCTTGCATGGAAGGAGGAAGG - Intergenic
1144412840 17:15018271-15018293 CTGATTGCCTGGATGGGGCATGG - Intergenic
1144936216 17:18901117-18901139 CTGCCTGTGTGGCTAGAGTAAGG + Intronic
1149112123 17:53046541-53046563 CTGTGTGTGTGTGTGGAGCAGGG + Intergenic
1151634075 17:75332044-75332066 CTGCTTCTGTGCTAGGAGCAGGG + Intronic
1152473645 17:80503833-80503855 GTGGATGTGTGGATGGAGGATGG + Intergenic
1152474846 17:80511285-80511307 TGGCGTGTGTGGATTGAGCATGG - Intergenic
1152539103 17:80965988-80966010 CTGCGTGTGCGGGTGGAGCTGGG - Exonic
1152600536 17:81260030-81260052 CTGCCTGTGTGCAGGGAACATGG - Intronic
1153749905 18:8218681-8218703 CTACTTTTGTGCATGAAGCATGG + Intronic
1156471484 18:37379827-37379849 CATTTTGTGTGCATGGAGCATGG + Intronic
1156502479 18:37568209-37568231 CTGCTTGTGTGGATGCAGCGTGG + Intergenic
1158452590 18:57580530-57580552 CTGCTCCTGTGGAAGGAGAAGGG + Intronic
1159988711 18:74876785-74876807 CGGCTTGTACGGCTGGAGCAGGG - Intronic
1160296856 18:77646481-77646503 TGGCTTGTGTGGATGGGGAAGGG + Intergenic
1160881838 19:1324524-1324546 CAGCTGGTGTGGCTGGAGCAGGG + Intergenic
1161435450 19:4260045-4260067 CAGCCTGTCTGGATGGAGCCTGG - Intronic
1162412220 19:10513374-10513396 ATGCTGGTGTGCCTGGAGCAGGG - Exonic
1162487636 19:10971236-10971258 CAGCCAGTGTGGCTGGAGCAGGG - Intronic
1162613697 19:11777840-11777862 CTGCTTGGGTGGCTGGTTCAAGG - Intronic
1162776865 19:12985013-12985035 CTGCTTGTGTGGACGGCTAAGGG + Intergenic
1163614077 19:18316433-18316455 CTGCTTGTGAGGCTTGAACACGG - Intronic
1163810591 19:19429149-19429171 CGCCTTGTGTCCATGGAGCATGG + Intronic
1164871424 19:31647506-31647528 CTGCTTCTGGGGAAGGTGCAGGG + Intergenic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1167355662 19:49002452-49002474 CTGGCTGTGTGGCTGGGGCATGG + Intronic
1168191464 19:54741426-54741448 CTCCCTATGTGGATGGAGCCTGG - Intronic
1168193735 19:54758054-54758076 CTCCCTATGTGGATGGAGCCTGG - Intronic
1168195790 19:54772792-54772814 CTCCCTATGTGGATGGAGCCTGG - Intronic
1168197687 19:54787644-54787666 CTCCCTATGTGGATGGAGCCTGG - Intronic
1168204161 19:54837023-54837045 CTCCCTATGTGGATGGAGCCTGG - Intronic
1168206361 19:54853200-54853222 CTTCCTATGTGGATGGAGCCTGG - Intronic
1168213150 19:54906380-54906402 GTGCTTGGGTGGAAGGAGCTTGG - Intronic
926346074 2:11946873-11946895 CTTCCTGGGTGGATGGAGGAAGG + Intergenic
926412039 2:12614667-12614689 CTGCTGTTGTGCATGGTGCATGG - Intergenic
927090207 2:19704846-19704868 ATCCTTGAGTGGAAGGAGCAAGG + Intergenic
928106119 2:28471637-28471659 TTGGTTGTGGGGATGGAGAAGGG + Intronic
928685376 2:33744334-33744356 CTGCTCCTGTGGAGGTAGCAAGG + Intergenic
930767022 2:55094997-55095019 CATGTTGTGTGGATGGAGTATGG - Intronic
932180725 2:69643772-69643794 CTGGTTGGGTGGATGGAGCCGGG - Intronic
932886929 2:75556990-75557012 CTGCTTTTGAGGGTGGAGTAGGG - Intronic
934737679 2:96698243-96698265 CTCATTGTGAAGATGGAGCAGGG + Intergenic
934946666 2:98547395-98547417 ATGCTGGGGTGCATGGAGCAGGG + Intronic
935293734 2:101630560-101630582 CTGCCTGTGAGGTTGGAACAGGG + Intergenic
935515117 2:104026819-104026841 CTGCCAGTGTGGGTGAAGCAGGG - Intergenic
935811792 2:106805734-106805756 CTTCTAGTTTGGAAGGAGCAAGG + Exonic
936701115 2:115012438-115012460 CTGCTTTGGTGGAGGCAGCAGGG - Intronic
937415061 2:121707986-121708008 CTGCTGGTGTGGTCAGAGCAAGG - Intergenic
937867284 2:126762090-126762112 CTGCTTATGTGGTTGGAGACTGG - Intergenic
938445139 2:131370672-131370694 TTGTTTGTGGGGATGAAGCAGGG + Intergenic
938996440 2:136683567-136683589 CTGCTTTGGTGGAGGTAGCAGGG - Intergenic
939833065 2:147095823-147095845 TTGCCTTGGTGGATGGAGCATGG - Intergenic
940008493 2:149031517-149031539 CTGATGGTGTGCATGGTGCAAGG - Intergenic
940903784 2:159150397-159150419 CTGCTTGTTAGTGTGGAGCAAGG - Exonic
941564383 2:167088225-167088247 CTGCTTTAGGGGATGGTGCAGGG - Intronic
941731506 2:168922899-168922921 CTACCAGTGTGGCTGGAGCAGGG - Intergenic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
946200854 2:218069936-218069958 CTGCGTGTGTGTGGGGAGCAGGG - Intronic
946201210 2:218071849-218071871 CTGCCTGTGTGTGGGGAGCAGGG - Intronic
946290597 2:218741660-218741682 CTGCTTTTCTGGAAGGAGGATGG - Intronic
948498314 2:238370019-238370041 CTGATTCTGGGGCTGGAGCAGGG - Intronic
1170086308 20:12535902-12535924 CTGCTTTGGTGGAGGTAGCAGGG - Intergenic
1171197611 20:23212630-23212652 CTCCTGGTGTGGAAGGAGCCAGG - Intergenic
1171361005 20:24586349-24586371 ATGCTTGTGCTGATGGAGAAGGG - Intronic
1171411064 20:24949379-24949401 CTTCTTGGGTAGATGGCGCAGGG - Exonic
1172481249 20:35273034-35273056 CAGCTTGTGTGGTGGGAGCTGGG + Intronic
1174554446 20:51383745-51383767 GTGCATGTGTGGGTGGGGCATGG + Intergenic
1175541041 20:59747814-59747836 CTGCTGGAGATGATGGAGCAGGG + Exonic
1175598120 20:60251825-60251847 CTGATTGAGTGGTTGGAGGATGG + Intergenic
1176188533 20:63795269-63795291 CGGCTTGTGAGTTTGGAGCATGG - Intronic
1178563926 21:33665529-33665551 TTGCTGGTGTGAATGTAGCATGG + Intronic
1179074183 21:38103084-38103106 CTGCATTTGAGGATGTAGCAGGG + Intronic
1179203488 21:39249542-39249564 CTGCTTTTGTGGTTGGGGAATGG - Intronic
1180700521 22:17779055-17779077 GTGTTGGTGGGGATGGAGCAGGG - Intergenic
1181060655 22:20280613-20280635 CTGGCTGGGTGGACGGAGCATGG + Intronic
1181485899 22:23231666-23231688 CAGCTTGTGTGGAGGAGGCATGG + Intronic
1182526857 22:30925962-30925984 CTCCATGTGTGGGTGCAGCAGGG - Intronic
1182665792 22:31958924-31958946 CTGCTTGGGAGGATGGAGCCCGG + Intergenic
1182742043 22:32574965-32574987 CTGCTAGTGTGCAAGGAGCAGGG - Intronic
1183723282 22:39574480-39574502 GTGCGTGTGTGGGTGGGGCAGGG + Intronic
1184640845 22:45869197-45869219 CTGCTTCTGAGAACGGAGCACGG - Intergenic
949606624 3:5660540-5660562 CAGCTGGTGTGGCCGGAGCAGGG + Intergenic
950379489 3:12599353-12599375 CTGCTGCTATGGAGGGAGCATGG - Intronic
950554513 3:13687146-13687168 CTCCTTGTGTGGAGGGAGGACGG + Intergenic
950873431 3:16248964-16248986 ATGTGTGTGTGGATGGGGCATGG + Intergenic
951301277 3:21000198-21000220 CTGCCTGTGCTGATGGAGCAAGG + Intergenic
952082927 3:29782285-29782307 CTGCTTTGGTGGAGGTAGCAGGG - Intronic
952279362 3:31908320-31908342 ATGCTTGGGTGGGTGGAGAAAGG + Intronic
952362337 3:32643323-32643345 CTGCTTTTGTGAGTGGAGCTTGG - Intergenic
955234112 3:57124507-57124529 CTGGTTTTGTGGATGGAGGAAGG + Intronic
956189658 3:66596540-66596562 CTTCTGCTGGGGATGGAGCAGGG + Intergenic
957548802 3:81677249-81677271 CTGCTTGTCTGGGTGTGGCAGGG - Intronic
959087688 3:101868748-101868770 CTGGCTTTGAGGATGGAGCAAGG + Intergenic
959611653 3:108301723-108301745 CTGCTTGAGTTGAGGGAGAAAGG - Intronic
960760663 3:121071353-121071375 CTGTTTGTGTGACTAGAGCAGGG + Intronic
961176871 3:124842891-124842913 GTGACTGTGTGGATGGAGAAGGG - Intronic
961511191 3:127404807-127404829 CAGCTAGTGAGTATGGAGCAGGG - Intergenic
961588243 3:127953406-127953428 CTGCTTTTCTGTATGGAGCCAGG + Intronic
961612271 3:128149736-128149758 CTGGTTGTGTGGCTGGCCCAAGG - Intronic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
964393207 3:156218644-156218666 CTGCTTCAGTGGAGGTAGCAGGG - Intronic
965620137 3:170634704-170634726 CTGCTTCTGTGGCTGCAGCTTGG - Intronic
966354706 3:179067711-179067733 CTGCTTAGGTGGAGGAAGCACGG + Exonic
966435976 3:179884395-179884417 CTGCTTTTGAAGATGGAGCAAGG + Intronic
966666127 3:182472929-182472951 CTGGTTTTGAGGATGGAGGAAGG - Intergenic
966826431 3:183968758-183968780 GTGGTAGTGTGGACGGAGCATGG + Intronic
968083649 3:195864049-195864071 CTGCTCCCGGGGATGGAGCAAGG - Exonic
968607503 4:1542427-1542449 CTGCTTGGGAGGTTGGAGCGGGG - Intergenic
968749252 4:2378724-2378746 TTGGGTGGGTGGATGGAGCAGGG - Intronic
969561044 4:7948545-7948567 CTACTTGGGAGGCTGGAGCAAGG - Intergenic
969662259 4:8537154-8537176 CTGCTTGTGCTGGTGGAGCTGGG + Intergenic
969689922 4:8698758-8698780 CTGCTGGTGTGGCTGGAGGGTGG - Intergenic
972806515 4:42533776-42533798 CTGCTTTGGTGGAGGTAGCAGGG - Intronic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
975280649 4:72558373-72558395 CTGGTTCTGAGGATGGAGGAAGG - Intronic
976430029 4:84952091-84952113 GTATTTGTGTGGTTGGAGCAGGG - Intronic
976648774 4:87412980-87413002 GTTCTTGTCTTGATGGAGCAAGG + Intergenic
978112152 4:104976384-104976406 CTGTTTGTGTGGCAGGAGCCTGG + Intergenic
978916143 4:114127821-114127843 CTGCTTTGGTGGAGGCAGCAGGG - Intergenic
980697838 4:136382635-136382657 CTGGTTGTGTGGTTGCAGCTAGG - Intergenic
981603806 4:146521809-146521831 CTGCATGTCTGGAGGGACCAAGG - Exonic
981765348 4:148242288-148242310 TTGCTGGTGGGGATGGAGGAAGG + Intronic
983729800 4:170979068-170979090 CTGCTTCTGTGGAGGTAACAGGG + Intergenic
984134398 4:175917230-175917252 GTGATTGTGTGGAGGGAGGAGGG - Intronic
984190559 4:176600881-176600903 CTGCTTTGGTGGAGGTAGCAGGG + Intergenic
985930141 5:3050904-3050926 CTGGCTGTGTGGTTGGATCAGGG + Intergenic
987846643 5:23295792-23295814 CTGCTTCAGTGGAGGTAGCAGGG + Intergenic
988436206 5:31178078-31178100 CGTCTTATGTGGCTGGAGCAGGG - Intergenic
989280211 5:39632583-39632605 CTGCTTGTGTGAAAGGTCCAGGG + Intergenic
989686458 5:44093706-44093728 CCACTTGTGAGAATGGAGCAAGG + Intergenic
990654048 5:57934990-57935012 CTGCTTGTGTGGTTGGCCCCTGG + Intergenic
991514309 5:67416797-67416819 CTGCTTCAAGGGATGGAGCAGGG + Intergenic
994793736 5:104266035-104266057 ATGATTGTGTGGATGAACCAGGG - Intergenic
997231043 5:132243391-132243413 CTGCTCCTGTGGAGGTAGCAGGG + Intronic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999241629 5:150131295-150131317 AGGCTTGTGTGGTTGGAACAGGG - Intronic
999519106 5:152332126-152332148 CTGCTTGTGTGGAGGGGGCAGGG + Intergenic
1000103703 5:158038667-158038689 CTGCTTGGGAGGATTGAGCCAGG + Intergenic
1001482230 5:172096345-172096367 CTGCTGGTGTGGGAGGGGCAGGG - Intronic
1001790636 5:174454745-174454767 CTGTGTGTGTTTATGGAGCAGGG - Intergenic
1001970441 5:175951079-175951101 CTGATTGTGTGGTAGGAGCCAGG - Intronic
1002246996 5:177892682-177892704 CTGATTGTGTGGTAGGAGCCAGG + Intergenic
1002709904 5:181189171-181189193 CTACTCGAGTGGATCGAGCAGGG - Intergenic
1002994226 6:2268013-2268035 TTGCTTGTATGGATGAAGCATGG + Intergenic
1003179893 6:3782509-3782531 CTGCCAGTGTGGAAGGAGCTGGG + Intergenic
1003958898 6:11191164-11191186 CTGCTTGCCGGGATGAAGCAGGG - Exonic
1004186806 6:13428045-13428067 CAGCTTGTGTTGATGTAGCTCGG - Intronic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1007309314 6:40932940-40932962 CTGTTTGTGTGGCGGAAGCATGG + Intergenic
1007694039 6:43720274-43720296 CTGCTTGAGTGGAAAGAGGATGG + Intergenic
1007932839 6:45707921-45707943 CTGCTGGTGTGGCTGGAGCCCGG + Intergenic
1009494735 6:64332672-64332694 CCTCCAGTGTGGATGGAGCAGGG - Intronic
1011154721 6:84317527-84317549 GTGTGTGTGTGGGTGGAGCAGGG + Intergenic
1013657707 6:112262712-112262734 CTCCTGGTGTGGATGGGGCCTGG + Intergenic
1014057123 6:117028954-117028976 CTTCATGGGTGGAGGGAGCAAGG + Intergenic
1016082315 6:139871030-139871052 CTGAATGTGTGGATGGGTCAAGG + Intergenic
1016889505 6:148992111-148992133 ACATTTGTGTGGATGGAGCAAGG - Intronic
1021554519 7:21905630-21905652 CTGCTTGTGTTCATTGTGCAGGG - Exonic
1022727519 7:32994577-32994599 CTGCTGGTGTGGGTGGAGTGGGG - Intronic
1022795435 7:33727903-33727925 CTCCTTGTGGGGGTGGGGCAGGG + Exonic
1023212320 7:37819996-37820018 CAGCTTCTCTGGGTGGAGCAGGG + Intronic
1024007969 7:45241394-45241416 CAGGTGGTGTGGATGGGGCAGGG + Intergenic
1025046067 7:55693072-55693094 CTGCTGGTGTGGGTGGAGTGGGG + Intergenic
1025088096 7:56039663-56039685 CTACTTGTGAGGCTGAAGCAGGG + Intronic
1027443499 7:78245809-78245831 CTTCTTTTCTGGAGGGAGCATGG - Intronic
1031090368 7:117347584-117347606 CTGCTCCGGTGGATGTAGCAGGG + Intergenic
1032556263 7:132838556-132838578 CTGCTTGAGTGGCTGAAACAAGG - Intronic
1034469529 7:151248041-151248063 CTGCTTGTGTCTCCGGAGCAAGG - Intronic
1034621224 7:152458543-152458565 CTGCTTGGGAGGCTGGGGCAGGG + Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1039510070 8:38084732-38084754 CTGGTTGTGTGACTAGAGCAGGG + Intergenic
1043531351 8:81154575-81154597 CTACTTGTGAGGCTGAAGCAAGG - Intergenic
1045284638 8:100779876-100779898 CTGCTTTTTTTGATGCAGCATGG + Intergenic
1045866210 8:106868493-106868515 CTGCATGTGTGCAGGGAGAAGGG - Intergenic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1048385950 8:133912697-133912719 CTGCTTGTGAGAGAGGAGCACGG - Intergenic
1048583461 8:135750204-135750226 CTGCTGGTGTGGGGGAAGCAGGG + Intergenic
1049302813 8:141880532-141880554 CTGCTTGTGAGGATGAAGCAGGG - Intergenic
1050379686 9:5014549-5014571 CCACTTGAGTGGTTGGAGCAGGG + Intronic
1051423245 9:16909584-16909606 GTGTTTGTGGGGATGGAGGAAGG + Intergenic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1051885613 9:21889779-21889801 CTGCTTCAGTGGAGGTAGCAGGG + Intronic
1053376046 9:37607202-37607224 CTGCTTGGGAGGCTGAAGCAGGG + Intronic
1056160451 9:83886087-83886109 CTGCCTGTGGGGAAGCAGCATGG - Intronic
1056359765 9:85843780-85843802 CTGCCTGTGGGGAAGCAGCATGG + Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1056957058 9:91090933-91090955 CTACCTGTGTGCATGGAGGAAGG - Intergenic
1057055034 9:91953932-91953954 CTGCTTGTGTGGATTCAGGGTGG - Intergenic
1057212753 9:93209640-93209662 GTGCTTGGGTGGAAGGAACAAGG + Intronic
1060093359 9:120764563-120764585 CTGGTGTTGTGGAAGGAGCACGG - Exonic
1061004498 9:127920975-127920997 CTGGCTGTGTGACTGGAGCAAGG - Exonic
1061516302 9:131092487-131092509 CTGCTAGTCTGGCTAGAGCAAGG + Exonic
1061717534 9:132529892-132529914 CTGCTGGTGAGGATGGAAAATGG - Intronic
1062445270 9:136591052-136591074 CTGAGTGTGTGGTTGGAGGAAGG + Intergenic
1186059955 X:5694194-5694216 CTGCTTTAGGGGATGGGGCAGGG - Intergenic
1187027294 X:15448790-15448812 CTGCTTGTGTGGATGGAGCAAGG - Intronic
1188985979 X:36768725-36768747 CTTCATGTGTGGATGGTGCATGG - Intergenic
1189567254 X:42255402-42255424 CTGCTTCAGTGGAGGCAGCAGGG - Intergenic
1193901233 X:87180330-87180352 TTGCTGGTGTGAATGGAGTAGGG + Intergenic
1194237251 X:91399534-91399556 CTGCTTGGGTGGAGGTGGCAGGG - Intergenic
1195873452 X:109512658-109512680 CTGCTTGTGGGAATGTAGAATGG + Intergenic
1196130331 X:112148435-112148457 ATGCTTCAGGGGATGGAGCAGGG + Intergenic
1196618090 X:117790805-117790827 CATCTTGTGTGGATGGATTAGGG - Intergenic
1196832967 X:119790848-119790870 CTGCTACTGTGGATGGGGGACGG - Intronic
1197250271 X:124208896-124208918 GTGCTTGTGTGGAAAGAGGAAGG + Intronic
1198256596 X:134929486-134929508 GTGTTTGTGTGGATTGAGTAGGG + Intergenic
1199424256 X:147682411-147682433 CTGCTTTGGTGGAGGCAGCAGGG - Intergenic
1199538611 X:148932172-148932194 CTGCTTGTGAGGATGAATCATGG + Intronic
1200398287 X:156003908-156003930 CTGCTTGGGGGTTTGGAGCAGGG + Intronic