ID: 1187030186

View in Genome Browser
Species Human (GRCh38)
Location X:15478777-15478799
Sequence AAGTGTGAGCAGAAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 577}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187030186 Original CRISPR AAGTGTGAGCAGAAGGCAGA GGG (reversed) Intronic
900276605 1:1833747-1833769 ACATTTGAGCAGCAGGCAGATGG + Intronic
900968471 1:5975975-5975997 AAGGGAGAGCTGAAGTCAGAGGG + Intronic
902725471 1:18333029-18333051 AAGTGTGTCCAGGAGGCTGAAGG + Intronic
903353203 1:22730592-22730614 ACGTTTGAGCAGAGGCCAGAAGG + Intronic
904410291 1:30320873-30320895 AAGTGTGGGCAGAAGGGGGGTGG + Intergenic
904600245 1:31668928-31668950 GAGTGGGAACAGAAGGCAGTGGG - Intronic
904835552 1:33333319-33333341 AAGAATGAGGAAAAGGCAGATGG + Intronic
904903572 1:33877103-33877125 ATGTGTGGGCAGAAGGCAAATGG + Intronic
905019754 1:34800864-34800886 AATTTTGGGGAGAAGGCAGAAGG - Intronic
905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG + Intronic
905861917 1:41357715-41357737 GAGTGTCTGCAGAAGCCAGAGGG - Intergenic
908769044 1:67579739-67579761 AAGTGTGTGCAGAGTGCAAAGGG - Intergenic
909534972 1:76726363-76726385 AAGTGAAATCAGAAAGCAGATGG + Intergenic
909791616 1:79686575-79686597 AGGTGTGAGCAGAAGGTATGAGG + Intergenic
910464922 1:87488470-87488492 AAGTGTTGGCTGAAGGCGGATGG + Intergenic
911445387 1:97985638-97985660 AACGGTGAGCAGAAGGAAGATGG - Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
912943923 1:114069065-114069087 CAGTTTGTGCAGAAGACAGATGG - Intergenic
913263785 1:117024906-117024928 AAGTAAAAGCAGCAGGCAGAGGG + Intronic
913414555 1:118590494-118590516 AAGAGTGGGGAAAAGGCAGAAGG + Intergenic
913571498 1:120124827-120124849 AAGTAAGAGAAGATGGCAGAAGG + Intergenic
914245792 1:145885196-145885218 AAGGGTTAGCAGAAGGCACAGGG + Intronic
914249686 1:145911532-145911554 AAGTGTAAGCAGAAATCTGAAGG + Exonic
914292419 1:146286448-146286470 AAGTAAGAGAAGATGGCAGAAGG + Intergenic
914390271 1:147215001-147215023 CAGGATGATCAGAAGGCAGAAGG + Intronic
914553463 1:148737231-148737253 AAGTAAGAGAAGATGGCAGAAGG + Intergenic
915654672 1:157349431-157349453 CAGTCAGAGCAGAAGGCAAAGGG + Intergenic
915740711 1:158116453-158116475 GAGGGTGAGCAGAAGCCAAATGG + Intergenic
915842112 1:159222222-159222244 AAGTCAGAGCAGAATGCATAGGG - Intergenic
916060440 1:161094803-161094825 AATTGAGGGCAGAAGACAGAAGG - Intergenic
916068534 1:161156084-161156106 AAGTGAGAGGAGAATCCAGATGG + Intronic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918576933 1:186072785-186072807 AAATGTGAGCAGAAGACTAATGG + Intronic
919264161 1:195238839-195238861 AAGTTTGATCATAAGGCAGGTGG - Intergenic
919355205 1:196513630-196513652 AAGTGAGAGCTGAAGGAAGAAGG - Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920778631 1:208966174-208966196 AAATGTAAGCAGATGACAGAGGG + Intergenic
921254411 1:213326094-213326116 AAGAGAGAGCGGGAGGCAGAGGG + Intergenic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
921747644 1:218755369-218755391 AAGTGAGAGCAATAGGCAGATGG - Intergenic
921961125 1:221035369-221035391 AAGTGTGAGCAGAGCACTGAGGG - Intergenic
922251842 1:223856495-223856517 GAGTGGGAGCAGAAGGGAGGCGG + Intergenic
922292357 1:224218992-224219014 CAGTCTGAGCTGAAAGCAGATGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922775648 1:228213212-228213234 AGGAGCGAGCAGGAGGCAGAGGG - Intronic
923051018 1:230391562-230391584 AGGTGTGAGGAGGAGGGAGAGGG - Intronic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
1063546901 10:6989973-6989995 AAGTGTGAGAAGAACCCGGATGG + Intergenic
1064346873 10:14540556-14540578 AAGTGTGGGCAGAAAGCTGGGGG - Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065239557 10:23692574-23692596 AGTTGTGAACAGAAGGCAGTGGG + Intergenic
1067087962 10:43252840-43252862 GAGGGTGAGCAGGAGGCACAGGG - Intronic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067542514 10:47166215-47166237 GTGTGTGAGCAAAAGCCAGAAGG + Intergenic
1069145616 10:64889275-64889297 TAGTCTGTGCAGAAGACAGATGG + Intergenic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1072994202 10:100229054-100229076 ATGTGTGAGAAGAGGGCTGAAGG - Intronic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1075029301 10:119011211-119011233 AAGGGTGAGCAGATCTCAGAAGG + Intergenic
1075240051 10:120770224-120770246 AAATGTGAGCAAAGTGCAGAGGG + Intergenic
1075515423 10:123104400-123104422 AGGCATGAGAAGAAGGCAGAAGG + Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076179698 10:128397627-128397649 AGGGGGGAGAAGAAGGCAGAAGG - Intergenic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076379694 10:130016549-130016571 AATAGTAAGAAGAAGGCAGAAGG + Intergenic
1076412623 10:130262723-130262745 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076412846 10:130264164-130264186 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076530780 10:131142950-131142972 GAGTGGGAGCGGGAGGCAGAAGG + Intronic
1076822658 10:132947143-132947165 CGGTGTCTGCAGAAGGCAGAGGG - Intergenic
1076984203 11:223624-223646 ACGTGTGAGGAGAAGGGAGAAGG - Intronic
1077735552 11:4786848-4786870 AACTGTGCTCAGAAGGAAGAAGG - Intronic
1078368864 11:10728756-10728778 AAGTATGGAGAGAAGGCAGAAGG - Intergenic
1078754001 11:14191443-14191465 AAGTGTGTGGGGAAGGAAGAAGG - Intronic
1078915543 11:15775173-15775195 AAATGTGAGGAGATGGCAGCAGG - Intergenic
1079276011 11:19038368-19038390 AAGTTGGAGAAGAAGGCATAGGG - Intergenic
1079304292 11:19308779-19308801 AAGAGTGAGGAGTGGGCAGAGGG - Intergenic
1079504303 11:21136249-21136271 ATGTGTGAGGAAAAGACAGAAGG + Intronic
1080017430 11:27522181-27522203 AAGTTTGAGGAGAGAGCAGAAGG - Intergenic
1080459600 11:32441723-32441745 TAGTGTGGGCAGAAAGCAAAAGG - Intergenic
1080855599 11:36109058-36109080 AAGGGTGAGCATGTGGCAGATGG + Intronic
1081312998 11:41595867-41595889 AAGTGTGTGCACAAGACTGAGGG - Intergenic
1081589300 11:44409765-44409787 GGGTGTGAGTTGAAGGCAGAGGG + Intergenic
1081684761 11:45034515-45034537 AGGTGTGAGCAGAAGAGAGGTGG - Intergenic
1081858842 11:46320569-46320591 AAGGGTGGGCAGGAGGCAGGTGG - Intronic
1081884118 11:46480103-46480125 AAGTGGAAGAGGAAGGCAGAAGG - Intronic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1082757050 11:57087727-57087749 AAGGGAGAGCAGAAAGCAGGAGG + Intergenic
1082921316 11:58497712-58497734 AAGGGTGAGAAGGAGGAAGAGGG + Intergenic
1083315637 11:61813463-61813485 AAGTGAGAGGTGAAGCCAGATGG + Intronic
1084039414 11:66532681-66532703 AAGGGGGTGCAGGAGGCAGAGGG + Exonic
1085158809 11:74322109-74322131 AAGTGTAAACAGGAGCCAGATGG + Intergenic
1085255443 11:75170077-75170099 ATGTGTGAGCAGGGGGCTGAGGG - Intronic
1085390761 11:76180975-76180997 GAGTGGGAGCAGCAGGCAGGAGG - Intergenic
1085671574 11:78469850-78469872 AAGTGGAATAAGAAGGCAGAGGG + Intronic
1087384923 11:97458776-97458798 AGGAATGAGTAGAAGGCAGAGGG + Intergenic
1087917766 11:103830743-103830765 ATGTCACAGCAGAAGGCAGAAGG - Intergenic
1088340373 11:108758716-108758738 AAGTGGAAACAGGAGGCAGAAGG - Intronic
1088620608 11:111678792-111678814 ATGTGTGGGCAGAAGCCAGTAGG + Intronic
1088732258 11:112693901-112693923 GGGTGTGAGCAGAAGGCGGTAGG - Intergenic
1088799368 11:113291218-113291240 ATGTGTGATTTGAAGGCAGAAGG + Intergenic
1089339562 11:117748404-117748426 AAGTGCCATCAGAAGGGAGAGGG - Intronic
1089386998 11:118074946-118074968 AAATGGGAGCAGAAGCCAGGAGG + Intergenic
1089406086 11:118198620-118198642 AAGTATGTTCAGAAGGCAAATGG - Intronic
1090592451 11:128287043-128287065 TATTGTGATCAGAAGGCAGGAGG - Intergenic
1090751392 11:129749186-129749208 AAGTATGTGCAGGAGGCAGAAGG - Intergenic
1090929626 11:131283863-131283885 AGATGTGAGCAGAAAACAGAAGG - Intergenic
1091002242 11:131919421-131919443 ATGTGTGAGCTGAAGGGAGAAGG + Intronic
1091585597 12:1814521-1814543 AAGTGAGAGCTGAAGCCAGCTGG - Intronic
1091887455 12:4027074-4027096 AAGTGTGTGCAGGAGAAAGAAGG - Intergenic
1091907208 12:4198617-4198639 ATCTGAGAGCAGAAAGCAGAGGG + Intergenic
1092061930 12:5558083-5558105 AAGTTTGAGCAGTTTGCAGAGGG - Intronic
1092403274 12:8196068-8196090 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1093761856 12:22920020-22920042 AAGTGTGGGCTGAAGGCCAATGG + Intergenic
1094089296 12:26630093-26630115 AACCATGAGCAGAAGGCAGGGGG + Intronic
1094102803 12:26781209-26781231 AGGTGTTTGCTGAAGGCAGAAGG + Intronic
1094123607 12:26999498-26999520 AAGAGGGAGGAGAAGACAGAAGG + Intronic
1096289046 12:50325197-50325219 AGGTGTTTGCTGAAGGCAGAGGG + Intergenic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1098428158 12:70389742-70389764 CAGTATGAGAAGTAGGCAGATGG - Intronic
1098623055 12:72628228-72628250 AACTGTGATGAGAAGCCAGATGG + Intronic
1099348672 12:81537048-81537070 AAGTCTGAGTGGAAAGCAGAAGG + Intronic
1100250411 12:92815972-92815994 AAGAGTGAGAGGAAGGCAGAAGG + Intronic
1100533104 12:95478742-95478764 AAGTGTGGGCTGAATGCCGAAGG + Intronic
1101401984 12:104396414-104396436 ATTTGGGTGCAGAAGGCAGATGG - Intergenic
1102459106 12:113089323-113089345 GAGTGAGAGCAGAGGACAGATGG + Intronic
1102546978 12:113664381-113664403 AGGTCTGAGCAGAAGAAAGAAGG + Intergenic
1103147859 12:118610972-118610994 AGCTGTGATCTGAAGGCAGAAGG - Intergenic
1103938370 12:124488701-124488723 AGGTGTGAGAAGAAAGCAGCAGG + Intronic
1104568768 12:129907270-129907292 AAATGTGAGCAGAAGTCATGGGG + Intergenic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1104722591 12:131053244-131053266 AAGTGGAAGCAGACAGCAGAGGG - Intronic
1104849081 12:131862652-131862674 AAAATTGAGCAGAAGGTAGAGGG + Intergenic
1105303857 13:19155944-19155966 AAGTGTGTGCAGAAAGCACATGG + Intergenic
1105476122 13:20729639-20729661 AATTGGGAGCAGATGGCAAAAGG - Intronic
1106948409 13:34854795-34854817 AAGTGTAAGGAGAAGCCAAAGGG - Intergenic
1107346885 13:39471437-39471459 AAGTGAGAGCAGAAACAAGAGGG + Intronic
1111092981 13:83471910-83471932 TAGAGTAAGCAGAGGGCAGAAGG - Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1114242290 14:20879611-20879633 AAGAGTGAGCATAAGCCTGAGGG + Intergenic
1114249214 14:20943496-20943518 AAGGGTGAGCATAAGCCTGAGGG + Intergenic
1114430869 14:22659245-22659267 AAATGTTAAGAGAAGGCAGAGGG - Intergenic
1114517484 14:23309134-23309156 AAGAGTGAGCAGGACACAGAGGG + Exonic
1115434489 14:33357684-33357706 AATTGGGACCAGAATGCAGAAGG - Intronic
1116070918 14:40044528-40044550 TTTTGTGAACAGAAGGCAGATGG - Intergenic
1116945550 14:50831581-50831603 AAGGGTGTTCAGGAGGCAGAAGG + Intergenic
1117101375 14:52351860-52351882 AAGTGTGAGCAATTGGCTGAAGG - Intergenic
1117841267 14:59862848-59862870 AAGTTTGAGAAGAGGGGAGAAGG - Intronic
1118276383 14:64389201-64389223 AAATGAGAGTAGAAGGAAGAGGG + Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118685533 14:68286807-68286829 ATGAGTCAGCTGAAGGCAGAGGG + Intronic
1118791172 14:69094347-69094369 TAGTGTGATCAGACTGCAGATGG - Intronic
1119188087 14:72658870-72658892 AAGTGTGCCCAGTAGGCACATGG + Intronic
1120217164 14:81692617-81692639 AAATGTGAGAATAAGGGAGATGG + Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121551637 14:94807215-94807237 AAATGTTTGCAGAAGGTAGAAGG - Intergenic
1121970229 14:98349199-98349221 GAGGGTGAGAAGAAGGGAGAGGG + Intergenic
1121994338 14:98590440-98590462 AGATGGGAGCAGAAGGGAGATGG + Intergenic
1122060924 14:99136225-99136247 AAGAGTGAGCAGGAGGCCAATGG + Intergenic
1122141332 14:99664609-99664631 AAGTGGGAGCTGAGGGCAGGGGG - Intronic
1122723873 14:103737723-103737745 AAGTGTGAGGAGATGGAGGAAGG - Exonic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1128334318 15:66776331-66776353 AAGTGGGTGCAGAAGGAAGGAGG - Intronic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1128865874 15:71115173-71115195 AAGTGAGAGGAAAAGGGAGAGGG - Exonic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1130241332 15:82195679-82195701 AAGTTTGAGCAGGAGGAAAATGG - Intronic
1130459091 15:84145474-84145496 AAGTTTGAGCAGGAGGAAAATGG + Intergenic
1130657100 15:85799290-85799312 ACATGTGAGCAGAAACCAGAAGG - Intergenic
1131116303 15:89798140-89798162 AAATGTGTACAGAAGGCAGGAGG - Intronic
1131173348 15:90193754-90193776 AGGTGAGTGCAGTAGGCAGAAGG + Intronic
1131635171 15:94225330-94225352 AAGTGTGACTGGAAGTCAGAAGG - Intergenic
1132065020 15:98723915-98723937 TAGTGTGCCCAGAAGCCAGAAGG + Intronic
1132093122 15:98961594-98961616 CAGTGTGAGCTGCTGGCAGAAGG - Exonic
1132210650 15:100019845-100019867 AAGTGTGAGCTGGAGGGAGATGG - Intronic
1132456753 16:28287-28309 AAGTTTGGGCAGAAGAGAGACGG - Intergenic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1133284492 16:4684252-4684274 TGGCGTGAGCAGCAGGCAGAGGG - Intronic
1133485380 16:6214579-6214601 AAGTGGGAGAAGGAGGGAGAAGG + Intronic
1133778639 16:8918987-8919009 AAGGGTGAGCGGAAGGCTGCAGG + Intronic
1134224075 16:12378245-12378267 TCGTGGCAGCAGAAGGCAGAGGG + Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135596303 16:23745987-23746009 ATTAGTGAGCAGAAGGGAGATGG + Intergenic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1136294321 16:29293052-29293074 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1136538269 16:30913290-30913312 AACTGTGAGCTGAAGGAAGGAGG + Intergenic
1137591062 16:49694191-49694213 AAGGGGGAGCAGGAGGGAGAGGG + Intronic
1137764880 16:50970352-50970374 AAGCCTGACCAGAAGCCAGAGGG + Intergenic
1137779734 16:51087891-51087913 AAGTGAGTGTAGAAGGCAGCAGG - Intergenic
1137864344 16:51877653-51877675 AAGTGTGAGCAGCTTGCTGAAGG - Intergenic
1138221079 16:55250854-55250876 AACTGTGGGGAGAAGGGAGAGGG - Intergenic
1138233335 16:55357498-55357520 GAGAGTTGGCAGAAGGCAGAAGG + Intergenic
1139027081 16:62831744-62831766 AAGTGTGAATAGCAAGCAGACGG + Intergenic
1139729261 16:68928704-68928726 AAGTTTGAGCAGATGAAAGAGGG + Intronic
1139821475 16:69724758-69724780 AAGTGAGAAGAGAAGGCAGAAGG - Intronic
1139910027 16:70392021-70392043 AAGTCAGTGCAGAAGACAGATGG - Intronic
1139965513 16:70742850-70742872 AAGTGAGAGGTGAAGGCAGCTGG + Intronic
1140908067 16:79427192-79427214 AAATGTGAGGAGTAGGCAAATGG + Intergenic
1140946823 16:79776501-79776523 AAGTATCAGGAGAAGGCAAAAGG - Intergenic
1142023637 16:87800525-87800547 AAGTCCTGGCAGAAGGCAGAAGG + Intergenic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142100227 16:88267099-88267121 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1143206188 17:5140717-5140739 AGGCATGAGCTGAAGGCAGAGGG - Intronic
1143300809 17:5909591-5909613 AGCTGTGAGCCCAAGGCAGAGGG + Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144388621 17:14772859-14772881 AACTGAGAGCAGAAGGCAGAAGG + Intergenic
1144628366 17:16857058-16857080 AGCTGTGAGCAGGAGGCAGGAGG + Intergenic
1144843903 17:18205954-18205976 AGGTGGGAGCAAAGGGCAGAAGG - Intronic
1145065821 17:19760442-19760464 CAGTGTGAGCTGAAGGCGCATGG - Intergenic
1145077885 17:19870141-19870163 AAGTGGGGGCAGGAGGCAGGGGG + Intergenic
1145159958 17:20567628-20567650 AGCTGTGAGCAGGAGGCAGGAGG + Intergenic
1145245219 17:21264689-21264711 AGCTCTGGGCAGAAGGCAGATGG - Intergenic
1145845356 17:28033902-28033924 AACTGTTAGCAGAAGGCAAGAGG - Intergenic
1146854730 17:36253070-36253092 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1146865890 17:36335306-36335328 AGACGTGAGCTGAAGGCAGAGGG - Intronic
1146870630 17:36376962-36376984 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1146877988 17:36428043-36428065 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1146956914 17:36941263-36941285 CACTTTGTGCAGAAGGCAGAGGG - Intronic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1147068760 17:37935918-37935940 AGACGTGAGCTGAAGGCAGAGGG - Intergenic
1147073513 17:37977586-37977608 AGACGTGAGCTGAAGGCAGAGGG + Intergenic
1147080283 17:38015455-38015477 AGACGTGAGCTGAAGGCAGAGGG - Intronic
1147085035 17:38057124-38057146 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1147096231 17:38139415-38139437 AGACGTGAGCTGAAGGCAGAGGG - Intergenic
1147100981 17:38181090-38181112 AGACGTGAGCTGAAGGCAGAGGG + Intergenic
1147140689 17:38459026-38459048 AAGTGTGGGAAGAAGACAGAAGG + Intronic
1147603641 17:41761269-41761291 AAGTGTGATCACCAGCCAGATGG - Intronic
1147915196 17:43881621-43881643 AAGGGTCAGCAGAAGGCTGCAGG + Intronic
1149362779 17:55911633-55911655 GAGTGTGGGAAGGAGGCAGACGG - Intergenic
1150083921 17:62264136-62264158 AGACATGAGCAGAAGGCAGAGGG + Intergenic
1150104877 17:62455357-62455379 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1150547149 17:66171021-66171043 AAGCGTGAGAATAAGCCAGATGG + Intronic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1151980711 17:77506798-77506820 TGCTGGGAGCAGAAGGCAGAGGG - Intergenic
1152094093 17:78263206-78263228 AGGTGGGGGCAGAAGGCACAAGG - Intergenic
1152268846 17:79312000-79312022 AAGGGGGAGGAGAAGGGAGAGGG - Intronic
1152271745 17:79328982-79329004 AGGTATGGGCTGAAGGCAGAGGG + Intronic
1152548848 17:81019289-81019311 AGGTCTGAGCACAAGGCAGCCGG + Intergenic
1153479857 18:5536309-5536331 AAGTGTAGGCAGCAAGCAGAAGG + Intronic
1153486320 18:5602431-5602453 GAGAGAGAGCAGAAGACAGAAGG - Intronic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1153541635 18:6161761-6161783 CAGAGTGAGCAGAATGCAGTGGG - Intronic
1153720850 18:7901108-7901130 AAGTGTGTGCAGAACCCAGTGGG - Intronic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1155265198 18:24085676-24085698 AATTGTGATCAGAGTGCAGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155670932 18:28370271-28370293 AGGCCTGAGCAGAAGGAAGAAGG + Intergenic
1156303752 18:35857793-35857815 TGGTCTGAGCAGAAGACAGATGG + Intergenic
1156365066 18:36418531-36418553 AAGTGTGTGTGGAAGGCACATGG + Intronic
1157977326 18:52341293-52341315 AAGTCTGCGCAGAATGTAGATGG + Intronic
1158083658 18:53624901-53624923 AAGAATCAGAAGAAGGCAGATGG - Intergenic
1158480493 18:57817398-57817420 GAGTGTGAGAAGAAGGCTCATGG - Intergenic
1159053152 18:63440500-63440522 AAGTGTGACCAGCAGTCCGAAGG - Intergenic
1159478322 18:68953762-68953784 TAGTCTGAGGAGAAGGCAAATGG + Intronic
1160398236 18:78587986-78588008 AGGTGTGTGCAGAAGGAAGGGGG + Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1163290747 19:16377592-16377614 AAGTGTAAGCAGGAGGCCCAAGG - Intronic
1163316284 19:16542533-16542555 AAGTGAGAGCGGGAGGCAGGCGG + Intronic
1163408077 19:17136046-17136068 AACTATGAGCAGATGGCAAAGGG - Intronic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1164761190 19:30729601-30729623 AAGTGTGAGCAGTGGGCTGTGGG + Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165802798 19:38563151-38563173 AGGGGTGAGCAGAAGGAAGCGGG - Intronic
1165820768 19:38674309-38674331 CAGTGTGAGTTGAAGTCAGAGGG + Intronic
1165828466 19:38718947-38718969 AAGGGTGGGCCGAAGGCAGTGGG - Intronic
1165944403 19:39433058-39433080 GAGTGGAAGCAGAAGGCAGGGGG - Intergenic
1166125221 19:40711176-40711198 AAGAGTCACCAGAAGACAGAGGG - Intronic
1166487414 19:43225288-43225310 CAGTGTGAGCAGAAAGGAAATGG + Intronic
1166494259 19:43287177-43287199 AAGTGTGAGCAGAAAGGAAACGG + Intergenic
1166560724 19:43730919-43730941 AAGTGAGAGCAGAAGACACGAGG + Exonic
1167809882 19:51820138-51820160 TAGTTTGAGGAGAAAGCAGAAGG + Intronic
1168028572 19:53661961-53661983 AAGAATGGGCAGGAGGCAGAAGG - Intergenic
1168042247 19:53768058-53768080 AAGTGTGAACAGAAGGGCAAAGG - Intergenic
925358552 2:3261341-3261363 ATGAATGAGCAGAAGGCTGAGGG + Intronic
925425271 2:3744192-3744214 ATGAGAGAGGAGAAGGCAGATGG + Intronic
926618351 2:15021949-15021971 AATTGTAGGCAGAAGGCAGAAGG + Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927294256 2:21435535-21435557 AAGTGTGAGCTGAACGAAGGGGG - Intergenic
927525173 2:23733406-23733428 AAGTTTAAGCAGCAGGTAGAGGG - Intergenic
927889852 2:26741503-26741525 GAGTGTGAGCACAGGGCTGATGG + Intergenic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
929450749 2:42035472-42035494 GAGTGTGAGGAGTAGGCTGAGGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
931249618 2:60518489-60518511 AAGAGTGAGCAGAAGGGACCAGG + Intronic
931378173 2:61726955-61726977 ATGTGTGAGCTGAAGTCAGCTGG - Intergenic
931790228 2:65658241-65658263 AAGTGGGAGGAAGAGGCAGAGGG - Intergenic
932792475 2:74667754-74667776 AAGAATGAGCAGAAGACAAAAGG - Intronic
932874885 2:75441378-75441400 AAGAGAGAGGAGAAGACAGAAGG + Intergenic
932901939 2:75710973-75710995 AGCGGTGAGCAGAAGGCAGGCGG - Exonic
934046788 2:88179093-88179115 AACTGTGAGGAGAAGGAAGGTGG + Intronic
934495796 2:94796728-94796750 AAGGGTGTGTGGAAGGCAGAAGG - Intergenic
934949561 2:98567154-98567176 AAGTGTGAGGAGGAGGCTGCTGG + Intronic
935976877 2:108586909-108586931 AGGTGGGAGTGGAAGGCAGATGG - Intronic
937129430 2:119496568-119496590 AAGTGGAAGAAGAAGACAGATGG + Intronic
937479209 2:122241579-122241601 AAGGGTGAGAAGAAGGAAGGAGG + Intergenic
937674709 2:124577604-124577626 GAATGTGGGCAGAAGGGAGATGG + Intronic
938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG + Intronic
938390160 2:130898678-130898700 ACCTGTGAGGAGAAGGCAGTGGG + Intronic
938463985 2:131515134-131515156 AAGTGTGTGCAGAAAGCACATGG - Intergenic
938702560 2:133892699-133892721 AAGTCTCAGCAGAAGGCAGGTGG + Intergenic
938755958 2:134379084-134379106 AAGTGGGAGAAAAAGCCAGAAGG - Intronic
939122623 2:138136342-138136364 AAGTGTAGGCAGTAGGCAAAGGG - Intergenic
939259912 2:139793642-139793664 AAGTGTGGACTGGAGGCAGAGGG - Intergenic
939447544 2:142329615-142329637 AAGTGTGAGAAGAAGAGTGATGG + Intergenic
939936063 2:148294874-148294896 AATGGAGACCAGAAGGCAGAGGG - Intronic
943065898 2:183085796-183085818 CATTGTAATCAGAAGGCAGAGGG + Intronic
943735468 2:191348979-191349001 AAGTATCAGCAGAAGTCAGGTGG - Intronic
944125347 2:196286587-196286609 AAGTGTACATAGAAGGCAGATGG - Intronic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
944488433 2:200232187-200232209 AGGTGCCAGCATAAGGCAGAGGG - Intergenic
944848184 2:203690155-203690177 AGGTGGCAGCAGGAGGCAGAGGG - Intergenic
944939334 2:204606527-204606549 AAATGTGAGCAGAAGTAACATGG - Intronic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946109622 2:217403183-217403205 AGGTGGGAGGAGAAGGGAGAGGG + Intronic
946483732 2:220080761-220080783 AATTGTGACCAGGAGCCAGATGG - Intergenic
946918660 2:224554071-224554093 AAGAGTGAGGAGAAGAGAGAAGG - Intronic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947915776 2:233830843-233830865 CAGTGTGGGCTGAAGACAGAGGG - Intronic
948467713 2:238160108-238160130 CACTGTCAGCAGGAGGCAGACGG + Intronic
949064019 2:241978757-241978779 CAATGTGAGCACAAGTCAGAAGG - Intergenic
1169241956 20:3989602-3989624 ACATGTGTGCAGAAGGAAGATGG - Intronic
1169928127 20:10804020-10804042 AAGTGTGAGTAGAATTCAGGGGG + Intergenic
1170281125 20:14650033-14650055 GAATGGGAGCAGGAGGCAGAAGG + Intronic
1170381509 20:15764900-15764922 TAGAGTGAGCAGAGAGCAGAAGG - Intronic
1170756589 20:19211737-19211759 AAGTGTGAGCCCAAGACAGAGGG + Intergenic
1171181519 20:23094341-23094363 CAGTGAGAGCAGAATTCAGATGG - Intergenic
1171471899 20:25378872-25378894 TAATGAGAGCAGAGGGCAGATGG - Intronic
1171749012 20:29029099-29029121 AGGTGTGAACAGGAGGCAGGAGG + Intergenic
1171812301 20:29754782-29754804 AAGTGAGAGAAACAGGCAGAAGG + Intergenic
1172417402 20:34781417-34781439 AAATGTGTGAAGAAGCCAGATGG + Intronic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173546555 20:43902497-43902519 AAGAGTGAAGGGAAGGCAGAAGG - Intergenic
1173596613 20:44262604-44262626 AAGAGTGAACACAAGGCATAGGG - Intronic
1173674776 20:44824186-44824208 AAGGGCAAGCTGAAGGCAGATGG - Intergenic
1175831765 20:61968531-61968553 AGGTGTGAGCAGAAGAGAGGCGG - Intronic
1176370426 21:6058879-6058901 AAGGGTGAGCAGAGGTCCGAGGG + Intergenic
1178238677 21:30873719-30873741 AAATGTGAGCAGAAGTCGTAGGG + Intergenic
1178463112 21:32821032-32821054 AAGTGTTATCAGAAAGAAGAGGG - Intergenic
1178471515 21:32897709-32897731 GAGCTAGAGCAGAAGGCAGAGGG + Intergenic
1178752483 21:35317922-35317944 AAGTGAGAGCATAAGGCAACTGG + Intronic
1179003636 21:37487985-37488007 AAGAGTGAGGAGAAGGCAGGAGG - Intronic
1179008641 21:37535848-37535870 AGGTTTGCGCAGAGGGCAGATGG + Intergenic
1179084815 21:38207422-38207444 AAGGGAGAGGAGAAGGGAGAAGG - Intronic
1179753093 21:43479662-43479684 AAGGGTGAGCAGAGGTCCGAGGG - Intergenic
1180157677 21:45986035-45986057 AAGTGGGAGCAGCAGGAAGGAGG - Intronic
1180393977 22:12312526-12312548 AGGTGTAAGCAGGAGGCAGAAGG - Intergenic
1180405770 22:12552224-12552246 AGGTGTAAGCAGGAGGCAGAAGG + Intergenic
1180673571 22:17571773-17571795 AAGTCTGGGCCCAAGGCAGACGG + Intronic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1182452212 22:30428395-30428417 ATGAGGGAACAGAAGGCAGAAGG - Intronic
1182541420 22:31044744-31044766 AAGTGTGTGAAAATGGCAGATGG + Intergenic
1182676545 22:32043588-32043610 AAGGATGAGCAGAAGTGAGAAGG + Intronic
1182711994 22:32328982-32329004 AAGAGGAAGCAGGAGGCAGAGGG - Intergenic
1183915896 22:41118836-41118858 AAGTGTGAATTGAAGACAGATGG + Intronic
1183933003 22:41246799-41246821 CACGGTGTGCAGAAGGCAGAGGG - Intronic
1184399538 22:44265866-44265888 AAGAGGAAGCAGGAGGCAGAGGG - Intronic
1184924999 22:47630510-47630532 AGGTGAGACCAGAAGGCAGAGGG - Intergenic
1185253496 22:49818324-49818346 GACTGTGATCAGCAGGCAGACGG - Intronic
1185325360 22:50222882-50222904 AGGGGTGAGCAGGAGGCCGAGGG + Intronic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
950281963 3:11715735-11715757 AAATGTGACCAGAAGCCGGAAGG - Intronic
951099366 3:18668848-18668870 AAGTGGAAGAGGAAGGCAGAAGG - Intergenic
951500429 3:23380553-23380575 AAATATGAGCAGAAGGTATAGGG - Intronic
951713625 3:25612713-25612735 AAGTATAATCATAAGGCAGAAGG + Intronic
952159398 3:30678586-30678608 AACTGTGTGCAGAAGGATGATGG + Intronic
952957168 3:38564635-38564657 AAGGCTGAGCAGAAGGAAGTGGG - Intronic
954117497 3:48475361-48475383 AGGAGGGAGCAGAAGGCAGAGGG + Intronic
955857342 3:63287323-63287345 AAAGGTGAGCAAAAGGGAGAGGG - Intronic
955886603 3:63605837-63605859 GAGTCTGAGCAGCAGACAGAGGG + Intronic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956220001 3:66892872-66892894 GAGGGTGAGCAGAAGCCAGGTGG + Intergenic
956571078 3:70695837-70695859 ATGTCTGACTAGAAGGCAGAAGG + Intergenic
956657104 3:71563074-71563096 AAGTGGGAGCAAACTGCAGAGGG + Intronic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
957274103 3:78068170-78068192 AAGAGAAGGCAGAAGGCAGAAGG + Intergenic
957363262 3:79186674-79186696 AAATGTGAGCAGAAGATTGAAGG + Intronic
958127688 3:89379115-89379137 AAATCTGAGCAGAAAGCAAAGGG - Intronic
958794840 3:98695813-98695835 AAGTGGGAGTAGAAGGGAGCTGG - Intergenic
959273324 3:104242279-104242301 AAATTTCAGCAGCAGGCAGATGG - Intergenic
959466877 3:106699214-106699236 AGGTGTGACTAGAAGGGAGATGG + Intergenic
961563224 3:127745856-127745878 AAGTGGGGACAGAAGGCACAGGG + Intronic
961707580 3:128800228-128800250 AATTCTCAACAGAAGGCAGAAGG + Intronic
962202743 3:133414526-133414548 AGGGGTGAGTAGAAGGGAGAGGG - Intronic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962203467 3:133417420-133417442 GAGGGTGAGTAGAAGGGAGAGGG - Intronic
962203630 3:133418107-133418129 AGGGGTGAGTAGAAGGTAGAGGG - Intronic
963043428 3:141085393-141085415 AAGGTGGAGCAGCAGGCAGAAGG - Intronic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963323811 3:143838784-143838806 AAATGTGAGCATAAAGAAGAAGG + Intronic
963661684 3:148134385-148134407 AGATGTGTGCAGAAGGCAAAGGG + Intergenic
964485851 3:157184668-157184690 CACTCAGAGCAGAAGGCAGAAGG - Intergenic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964939798 3:162143901-162143923 AAGTGGGAGAGGAAGGCAAATGG - Intergenic
965034736 3:163423991-163424013 AGGTGTTTGCAGAAGGCAAAGGG - Intergenic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965532845 3:169791912-169791934 TAGTGGGAGCAGAAACCAGATGG + Intergenic
966188518 3:177249442-177249464 AGGTGTGAGCAGAAGCAACACGG - Intergenic
967519294 3:190410235-190410257 AAGTGTGTGCATAAGGTGGAAGG - Exonic
967681863 3:192372844-192372866 AACTGTGGGCAGGAGCCAGATGG - Intronic
967772643 3:193351792-193351814 AATCATGAGCAGAAAGCAGAAGG + Intronic
968335883 3:197913165-197913187 AAGAAAGAGCAGCAGGCAGATGG - Intronic
968604400 4:1525307-1525329 AAGTGCAACCAGAAGTCAGAAGG - Intergenic
968705656 4:2076212-2076234 AAGTGCAAGCACAAGGCGGACGG + Intronic
968972740 4:3804326-3804348 AAGAGTGAGCAGGAGTCAGCTGG - Intergenic
969483129 4:7457421-7457443 AGGTGTGAGCTGCAGCCAGAGGG + Intronic
969483141 4:7457491-7457513 AGGTGTGAGCCGCAGCCAGAGGG + Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969762792 4:9201792-9201814 ATGGGAGAGCAGATGGCAGAAGG + Intergenic
970274658 4:14385495-14385517 AAGTGGAAGAAGAAGACAGAAGG + Intergenic
970369635 4:15394053-15394075 AAGTTTGAGCAGAACCCTGAAGG + Intronic
972838249 4:42901462-42901484 TAGTGGAAGCAGAAGTCAGAAGG - Intronic
973157750 4:46978240-46978262 ATGAGTGAGAAGGAGGCAGAAGG + Intronic
973334637 4:48943565-48943587 AGGTGAGAGCAGACAGCAGAGGG + Intergenic
973553214 4:52056138-52056160 AAGAGTGAGGAGAGGGCTGAGGG - Intronic
973638260 4:52879587-52879609 AAGTGTGGGCTGAAGGCTGCTGG - Intronic
973808432 4:54547626-54547648 AGGTGGAAGCAGAAGGCAGAAGG - Intergenic
974411241 4:61543317-61543339 AAGTGGAAGCAGGAGGCAAAGGG + Intronic
974629086 4:64459577-64459599 AATTGTGTGTAGAGGGCAGAAGG + Intergenic
976423289 4:84870701-84870723 AAGTGAGACCAGAAGGCAAAGGG - Intronic
976681137 4:87757427-87757449 GAGTGTGAGGAGAAGGAAAAGGG + Intergenic
979528070 4:121738323-121738345 AATTCTGAGCAGGAGGCTGAAGG + Intergenic
979595452 4:122529653-122529675 AAGTGCCTGCTGAAGGCAGAGGG - Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
981904206 4:149902272-149902294 ATGAGTAAGCAGAAGGCATAAGG + Intergenic
983231027 4:165129012-165129034 AACAGTGAGGAGAAGGCTGAGGG + Intronic
983285006 4:165728151-165728173 AAGTATGAGCAGAAGAAAGTTGG + Intergenic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
984495959 4:180497480-180497502 AAGTGTGAGGAAAGGGCACACGG - Intergenic
984611554 4:181844861-181844883 AACTGTTAGCAGCAGGCTGAGGG - Intergenic
984897436 4:184554022-184554044 AGATCTGAGCAGAAGGCAGATGG - Intergenic
984922579 4:184778573-184778595 AAGTGTGGGCGCAGGGCAGAAGG - Intronic
985042528 4:185905938-185905960 GAGTATGAGAAGGAGGCAGAGGG - Intronic
985931282 5:3059565-3059587 AAGTGTGCTAAGACGGCAGAAGG - Intergenic
986341033 5:6789350-6789372 ATGTGTGAGCAGAATGCTGGAGG + Intergenic
986456760 5:7927633-7927655 AGGTGTGCACAGAAGGCAGGTGG + Intergenic
988707407 5:33739809-33739831 AAGGGTGTAAAGAAGGCAGAAGG + Intronic
988709421 5:33758612-33758634 AATTCTGAGCAGAAGGAGGAAGG + Intronic
988853925 5:35208113-35208135 AAGTGTGAGCAGGAGGCCACTGG - Intronic
988959333 5:36353923-36353945 AAAAGAGAGCAGAGGGCAGAAGG + Intergenic
989199882 5:38752589-38752611 ATGTGAGAGCAGAAGGGAAAAGG - Intergenic
989436462 5:41418951-41418973 AAGGCTGAGCAGCAGGCAGCTGG + Intronic
990191318 5:53263301-53263323 ATGTGTGAGTAGAAAGCAGAGGG - Intergenic
990515196 5:56524719-56524741 AAATGTGAGAAGCAGGCAGCTGG - Intronic
991116668 5:62963145-62963167 CAGTGTGTGCAGAAGTCACATGG + Intergenic
991202556 5:64010970-64010992 AACTGAGAGAAGAAGGCAGAAGG - Intergenic
992028278 5:72693017-72693039 AAGTGTCTGCAGAAGGCAACAGG + Intergenic
993432449 5:87848659-87848681 AGGTGAGAGAAGAAGGCAGGTGG - Intergenic
993533124 5:89047985-89048007 AAATGTGAGCAGTTGGCAGTTGG - Intergenic
993998988 5:94755480-94755502 TGGTGAGAGCAGAACGCAGAAGG - Intronic
994305044 5:98192876-98192898 GAGTGTGAGCAGAGAGCAAAGGG + Intergenic
994355989 5:98794242-98794264 AAGTGAGGGCAGAAGGGTGAGGG - Exonic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
995359134 5:111274051-111274073 CAGTGTGAGCAGAAAGGAGTGGG - Intronic
995568319 5:113454445-113454467 AATTGAGAGCCCAAGGCAGATGG + Intronic
995649493 5:114353762-114353784 AATAGTGACCAGAAGGCAGTGGG - Intergenic
996001476 5:118369239-118369261 AGGAGAGAGGAGAAGGCAGAAGG - Intergenic
996102738 5:119461017-119461039 AAGTGAGAGATGAGGGCAGAGGG + Intronic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996851638 5:127959604-127959626 AAGTGAGAGCATAAGGTAAACGG - Intergenic
997179769 5:131815860-131815882 AAGTGCCTGCTGAAGGCAGAAGG + Intronic
997530099 5:134576733-134576755 AAGTGAGAGGAGGAGGGAGATGG - Intronic
998388540 5:141772459-141772481 ATGTGTGGGCCGAGGGCAGAAGG + Intergenic
999041871 5:148422824-148422846 AATTGTTTGCAGTAGGCAGAGGG - Intronic
999228225 5:150045282-150045304 AAATGTGACCAAAAGGCAGGTGG + Intronic
999521728 5:152357856-152357878 TGGTGTGTGCAGATGGCAGATGG - Intergenic
999720577 5:154396379-154396401 AGGTGGGAGCAGGTGGCAGAGGG + Intronic
1001200235 5:169709279-169709301 AGTTGTGGGGAGAAGGCAGAGGG + Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001532988 5:172477800-172477822 GAGAGGGAGCAGAAGGCAGCAGG - Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1002305375 5:178279799-178279821 AGGTGTGAGTCGAAGTCAGAAGG - Intronic
1003640873 6:7874117-7874139 AAGAGTGAGTGGAAGGCTGATGG + Intronic
1003667111 6:8121682-8121704 CAGTGTGGGCAGCAGGCACATGG - Intergenic
1004022530 6:11788251-11788273 AAGGATGAGGAGAGGGCAGAGGG - Intronic
1004191106 6:13464298-13464320 AAGTAAGGGCAGAAGGCAGTGGG + Intronic
1005392338 6:25346224-25346246 AAGTGGGAGATGAAGCCAGAGGG - Intronic
1005819882 6:29588957-29588979 ATGGGTGTGAAGAAGGCAGAGGG - Exonic
1006385536 6:33728765-33728787 AAGGGTGCTCAGGAGGCAGAGGG - Intronic
1006925697 6:37654089-37654111 AACTGCCAGCAGATGGCAGAAGG - Intronic
1007251332 6:40497168-40497190 ACGTGGAAGCAGAAGGCAAACGG - Intronic
1007729331 6:43936372-43936394 AAGCGGGAGCAGAAGGCATGGGG - Intergenic
1008008584 6:46438720-46438742 AAGTGAGAGATGGAGGCAGAAGG - Intronic
1008546352 6:52587134-52587156 ATGAGTGAGCAGAAGATAGATGG + Intergenic
1010049134 6:71482781-71482803 AAATGTGAGCAGAGGTGAGATGG - Intergenic
1010699673 6:79028156-79028178 GAGTGTGAGGTGAAGGCATAAGG + Intronic
1010712582 6:79192516-79192538 ATGTCTGAGCAGAAGGTTGATGG - Intergenic
1010769272 6:79810130-79810152 CTGTGTGAGCTTAAGGCAGAAGG + Intergenic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011075288 6:83431465-83431487 AAGTGCGAGAAGATGCCAGAAGG + Intergenic
1011079012 6:83469079-83469101 AAATGTGAGAAAATGGCAGATGG + Intergenic
1011582192 6:88881298-88881320 AAGTGGGGGCAGGGGGCAGAGGG + Intronic
1011780816 6:90787377-90787399 AAATGTGTGCAGAGGGTAGAAGG + Intergenic
1012230739 6:96758385-96758407 AATCATGGGCAGAAGGCAGAGGG - Intergenic
1012309659 6:97706573-97706595 AATTGTAAGCAGAGTGCAGAAGG - Intergenic
1012817182 6:104039096-104039118 AAACGGGAGCAGAAGGCAGAAGG + Intergenic
1013572920 6:111448178-111448200 AAGTGAGAGCCAAAGGCAAATGG + Intronic
1014760677 6:125353381-125353403 AAGGGTGAGGAAAAGGAAGAAGG + Intergenic
1015528810 6:134200248-134200270 AAGTGTGAGCAGTAAGATGACGG + Intronic
1015541442 6:134317959-134317981 AAGAAAGAGCAGAAGCCAGAGGG + Exonic
1015661384 6:135578169-135578191 AATTTTGAGAAGAAGCCAGAGGG + Intergenic
1016291087 6:142528892-142528914 AAATGTGAGCTGAAGGGGGATGG - Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017005752 6:150027216-150027238 ACCTGTGGGCAGAAGGCAGAGGG + Intergenic
1017012121 6:150069984-150070006 ATCTGTGGGCAGAAGCCAGAGGG + Intergenic
1017256578 6:152340282-152340304 AGGTGTGAGCAGAGGTCGGAGGG + Intronic
1017722706 6:157255160-157255182 GAATGTGAGCAGAAGGCATGTGG + Intergenic
1018009246 6:159654902-159654924 AACTCAGAGCAGATGGCAGATGG + Intergenic
1018158313 6:161011454-161011476 AAGTGTGTGAAGAAGGGAGGGGG - Intronic
1018427602 6:163697822-163697844 AGGTGTGGGTAGAATGCAGAGGG + Intergenic
1019173597 6:170148451-170148473 ACGTGTTGGTAGAAGGCAGAAGG - Intergenic
1020396932 7:7727084-7727106 AGGTGTGTGCTGAAGGCAAAGGG + Intronic
1020836551 7:13159762-13159784 AAATGTGAGGAGAAGGGTGATGG + Intergenic
1020846911 7:13297251-13297273 AAATGACAGCAGCAGGCAGAAGG - Intergenic
1023246093 7:38205818-38205840 AACAGTGATTAGAAGGCAGAGGG - Intronic
1023551578 7:41375670-41375692 AAAATTGAGCAGAAGGCACAGGG + Intergenic
1023615375 7:42014317-42014339 AAGTATGTCCGGAAGGCAGAAGG - Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1024238495 7:47415643-47415665 GAGTATGAGCAGAAAGCAGCAGG - Intronic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1027510511 7:79073540-79073562 AAGTGTGAGGAGAATGGAGTTGG - Intronic
1027630466 7:80598003-80598025 AACTGAAAGCAGAAAGCAGAAGG - Intronic
1027639030 7:80711652-80711674 AAGTGTGAGCAGAGAGCCAACGG - Intergenic
1027721228 7:81744026-81744048 AAGTGAGAGCAGAAGGGATATGG - Intronic
1028016165 7:85716136-85716158 AAATATGAGCAGAGGGCAAATGG - Intergenic
1028623257 7:92847502-92847524 TGTTGTGTGCAGAAGGCAGAGGG - Intergenic
1029493429 7:100884523-100884545 AAGGATGAGAAGAAGGAAGACGG + Exonic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1031999514 7:128255609-128255631 ATGTTTGGGCAGAAGGGAGAAGG + Exonic
1032034048 7:128508575-128508597 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1032314058 7:130817692-130817714 AGGTGTTTGCAGATGGCAGATGG + Intergenic
1032468830 7:132163704-132163726 AACTTAGAGCAGAAGGCAGTGGG + Intronic
1032539078 7:132688357-132688379 AAGTGGCTGCAGAAGGCAGTGGG - Intronic
1032543626 7:132724483-132724505 ATGTGTGAGCAGAGGTCAGCAGG - Intronic
1033246426 7:139720287-139720309 AAGTCAGAGCTGAAGTCAGATGG - Intronic
1033618761 7:143042715-143042737 AATTGTGAGCAGAAGGAGGGAGG - Intergenic
1035387361 7:158483078-158483100 AAGTGTGATCGGAGGGCAAAGGG - Intronic
1035796263 8:2360004-2360026 AAATGTGGGCAGCAGGAAGAGGG + Intergenic
1036115876 8:5960399-5960421 AAGTGTTAGCAGGAAGCAGTTGG - Intergenic
1036865108 8:12389604-12389626 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1037380538 8:18280778-18280800 AGTTGTGAGCAGAACTCAGATGG + Intergenic
1038149991 8:24934342-24934364 TAGTGGGAGCAAAAGACAGAAGG - Intergenic
1038474630 8:27856537-27856559 AAGTGGGAGCCGACGGGAGAGGG - Intergenic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1039211359 8:35218642-35218664 AAGTGTCATCCCAAGGCAGAAGG - Intergenic
1039447466 8:37644073-37644095 AAGGGTGAGCAGAAGGCAGGTGG + Intergenic
1039903762 8:41771440-41771462 AAGTATGAACAAAATGCAGATGG - Intronic
1039906792 8:41792177-41792199 AAGGGTGAGCGGGAGGCAGCAGG + Intronic
1040051309 8:43017087-43017109 AAGGATGTGCAGAAGACAGAAGG - Intronic
1041405714 8:57497044-57497066 AAGTGAGAGCAGAAGGTATTAGG - Intergenic
1041578121 8:59423063-59423085 ATGTATGAGCAGAGGGCAGGGGG - Intergenic
1042028271 8:64446935-64446957 AAGTGACAGCAGAAAGCTGAGGG - Intergenic
1042975745 8:74467183-74467205 AAGTTTGAGGAGAAAGGAGAAGG + Intronic
1043267524 8:78285470-78285492 AAGGAAGAGCATAAGGCAGAGGG + Intergenic
1044254044 8:90039091-90039113 AAGTATGAGAAGAAGGTTGATGG - Intronic
1044286072 8:90413360-90413382 CAGCCTGTGCAGAAGGCAGATGG - Intergenic
1044467108 8:92520355-92520377 AAAGCTGAACAGAAGGCAGAAGG + Intergenic
1044691059 8:94878919-94878941 AAGTTTAAGGAGTAGGCAGAAGG - Intronic
1045258811 8:100553293-100553315 AAGACTGAGGAGAGGGCAGAGGG + Intronic
1046804091 8:118461099-118461121 AACTGTGAGAACAAGGCAGAGGG - Intronic
1047250774 8:123180728-123180750 AAGAGTTGGCAAAAGGCAGAAGG + Intronic
1047462894 8:125085733-125085755 AGGGGTGAGCAGATGGTAGAAGG + Intronic
1047683647 8:127280945-127280967 TAGTGTGAGCAGAACTGAGATGG + Intergenic
1047732186 8:127736816-127736838 ATGGGAGAGGAGAAGGCAGAGGG + Intronic
1048000788 8:130377888-130377910 AAGTGTGGGCAGTGGGCAGGGGG - Intronic
1048317009 8:133369992-133370014 CAGTGTGAGGGGCAGGCAGAGGG - Intergenic
1048617700 8:136095887-136095909 AAGTGTGGGCAGAAGGTCCATGG + Intergenic
1048928032 8:139288064-139288086 AAGTCTGTGCAGAAGACAGGAGG + Intergenic
1049371454 8:142269828-142269850 AGGCGTGCGCAGAAGGCAGCTGG + Intronic
1049390676 8:142368709-142368731 AGGTGCCAGCAGACGGCAGACGG + Intronic
1050096301 9:2070418-2070440 AAGGCTGAGGAGAATGCAGAGGG + Exonic
1050274870 9:3986201-3986223 AGGTATTAGCAGAAGACAGAGGG - Intronic
1050775684 9:9257224-9257246 AACTCTGAGCAGAAGGAAGGAGG + Intronic
1050994525 9:12198280-12198302 GAGTGTGAGCAGAAGTGAGTGGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1054891152 9:70253374-70253396 AAGGGAGGGAAGAAGGCAGATGG - Intergenic
1055277107 9:74630468-74630490 GAATGTCAGCAGCAGGCAGAAGG - Intronic
1056089054 9:83186568-83186590 CAGTGTTTGCAGCAGGCAGAAGG - Intergenic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1056551629 9:87657891-87657913 AAGTTTCAGGAGAAGGGAGATGG + Intronic
1056722694 9:89085319-89085341 AAAAGTGAACAGAAGGCTGAGGG - Intronic
1057221752 9:93261253-93261275 AAATGGGGGCAGAAGACAGAGGG + Intronic
1057321046 9:94013099-94013121 AAGAGTGAGCAAGAGGGAGAAGG - Intergenic
1057460233 9:95254424-95254446 GAGGGTGAGCAGAAGCCAGGTGG + Intronic
1057578292 9:96261758-96261780 AAGTCTGAGGAGTAGGGAGATGG - Intronic
1057873523 9:98735592-98735614 AAGTGGAAGCAGAAGGCTAATGG - Exonic
1059450737 9:114370257-114370279 GAGTCTGAGCAGATGGCTGAGGG - Intronic
1060254516 9:122015434-122015456 AGCTGTCAGAAGAAGGCAGATGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060671224 9:125471451-125471473 AAGAGTTAGGAGTAGGCAGATGG + Intronic
1060805470 9:126573134-126573156 AAGTCAGAGCTGTAGGCAGATGG - Intergenic
1061074452 9:128332651-128332673 AAGAGTGAACAGAAGGGAGTAGG - Intronic
1061279498 9:129589154-129589176 AAGTGTCACCAGAAGCCAGTGGG - Intergenic
1061433215 9:130544333-130544355 AAGAGTGAGCAGATGCAAGAGGG - Intergenic
1061607843 9:131724900-131724922 ATGGGTAAGCACAAGGCAGATGG - Intronic
1062394914 9:136348915-136348937 ATGGGTGAGCAGGTGGCAGATGG - Intronic
1062721043 9:138044208-138044230 AGGTGTGATGGGAAGGCAGATGG - Intronic
1185559376 X:1047524-1047546 TTATGTGAGCAGAAGGAAGATGG - Intergenic
1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG + Intronic
1186392573 X:9175605-9175627 AAGTAAGATCAGAAAGCAGATGG - Intergenic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1188550391 X:31358056-31358078 AAGTGTGCAAAGAAGACAGAGGG - Intronic
1188744090 X:33820443-33820465 AAGTGGGAGCAAAAGAGAGAGGG - Intergenic
1189437481 X:41005890-41005912 TAAAGAGAGCAGAAGGCAGAAGG - Intergenic
1189712363 X:43826694-43826716 AAGTATGAGCAGAAGGAAAGGGG + Intronic
1189845486 X:45132523-45132545 AAGTGAGAGAAGAAGGGAGGAGG + Intergenic
1190124930 X:47695874-47695896 AAGTGAAATCAGAAGGCAGAAGG - Intergenic
1192473740 X:71420972-71420994 AAGAGTGAGCAGGCGGCAGCGGG - Intronic
1192474413 X:71427551-71427573 AAAAGTAAGCAGAGGGCAGATGG + Intronic
1194050265 X:89059467-89059489 AAGTGTGATCAGAGGACAAAAGG + Intergenic
1194705116 X:97165825-97165847 AAGTATAAGCAAAAGGCACAAGG + Intronic
1194709735 X:97220601-97220623 ATGTGGGAGCAGATGGCAGCTGG + Intronic
1196787105 X:119430527-119430549 CAGTGTCAGCAGCAGGCTGATGG + Intronic
1196932489 X:120695721-120695743 GAGTCTGAGCTGAAGGCTGAAGG + Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197168295 X:123403522-123403544 AAGTGTGAACAGAAGGTAGGTGG + Intronic
1198393932 X:136204674-136204696 GTGTGTCAGCAGGAGGCAGAAGG + Intronic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1199880491 X:151970771-151970793 AGGAGTGAGGAGCAGGCAGAGGG + Intronic
1199979715 X:152914286-152914308 AAGTATGGGCAGAAGCCAGGGGG - Intergenic
1200399609 X:156011436-156011458 AAGTTTGGGCAGAAGAGAGACGG + Intergenic
1200651922 Y:5849691-5849713 AAGTGTGTGCTGAAGGTAAAGGG + Intergenic
1201711047 Y:16992486-16992508 AAGTGAGAGGAGAAGCCAGCTGG + Intergenic