ID: 1187035740

View in Genome Browser
Species Human (GRCh38)
Location X:15537622-15537644
Sequence AACTCCGTCCTGCACTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187035727_1187035740 24 Left 1187035727 X:15537575-15537597 CCTGTGGTCTTCCAAACTCCACC 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1187035740 X:15537622-15537644 AACTCCGTCCTGCACTATAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1187035728_1187035740 13 Left 1187035728 X:15537586-15537608 CCAAACTCCACCCCTCCTGCTTC 0: 1
1: 1
2: 9
3: 71
4: 630
Right 1187035740 X:15537622-15537644 AACTCCGTCCTGCACTATAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1187035732_1187035740 1 Left 1187035732 X:15537598-15537620 CCTCCTGCTTCTCCCCTCATACC 0: 1
1: 0
2: 5
3: 64
4: 637
Right 1187035740 X:15537622-15537644 AACTCCGTCCTGCACTATAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1187035733_1187035740 -2 Left 1187035733 X:15537601-15537623 CCTGCTTCTCCCCTCATACCCAA 0: 1
1: 0
2: 0
3: 30
4: 535
Right 1187035740 X:15537622-15537644 AACTCCGTCCTGCACTATAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1187035731_1187035740 2 Left 1187035731 X:15537597-15537619 CCCTCCTGCTTCTCCCCTCATAC 0: 1
1: 0
2: 13
3: 45
4: 673
Right 1187035740 X:15537622-15537644 AACTCCGTCCTGCACTATAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1187035730_1187035740 3 Left 1187035730 X:15537596-15537618 CCCCTCCTGCTTCTCCCCTCATA 0: 1
1: 0
2: 1
3: 55
4: 603
Right 1187035740 X:15537622-15537644 AACTCCGTCCTGCACTATAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1187035729_1187035740 6 Left 1187035729 X:15537593-15537615 CCACCCCTCCTGCTTCTCCCCTC 0: 1
1: 2
2: 38
3: 378
4: 2450
Right 1187035740 X:15537622-15537644 AACTCCGTCCTGCACTATAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187035740 Original CRISPR AACTCCGTCCTGCACTATAA GGG Intronic
901622245 1:10597912-10597934 AGCTCCGCCCTGCACCATACTGG - Intronic
904364271 1:30000436-30000458 AATTCAGCCCTGCACTGTAATGG + Intergenic
904622573 1:31784072-31784094 GGCTCCATCCTGCAGTATAAGGG - Intergenic
915022591 1:152795675-152795697 AACCCCGTCCTGGACCATAAGGG - Intronic
919720012 1:200823759-200823781 ACCTCCATCCTGCACTCCAAAGG + Intronic
922806388 1:228392161-228392183 AACTGTGTCCTGCACTGTCAGGG - Intergenic
1069982171 10:72260470-72260492 AACTCCTTCCTGCACTAGCTGGG + Intergenic
1076231946 10:128827472-128827494 ATCTCCCTCCTGCATTGTAACGG - Intergenic
1090904239 11:131060412-131060434 AATTCCATCCTGCAATATGAGGG + Intergenic
1100908984 12:99336826-99336848 TACTCTGTCCTGGCCTATAAGGG + Intronic
1103155473 12:118680904-118680926 AAGTCTGTCCTGCACAACAAAGG + Intergenic
1105288204 13:19025497-19025519 AAATTCTTCCTGAACTATAAAGG + Intergenic
1105656197 13:22441483-22441505 AAATCTGTCCTGCAGTAAAATGG - Intergenic
1108277322 13:48824042-48824064 AACTCCTGCCTGCACTACAGGGG + Intergenic
1109084171 13:57949288-57949310 AAATCCCTCTTTCACTATAAGGG - Intergenic
1114161470 14:20172928-20172950 AAATTCTTCCTGAACTATAAAGG + Intergenic
1114530498 14:23392644-23392666 AACTCCTTCCTGCAGGAGAAGGG + Exonic
1115744793 14:36425538-36425560 ATCTCAGTTCTGCCCTATAATGG + Intergenic
1129999299 15:80033457-80033479 ACCTCAGTCCTGCACTAGAGGGG + Intergenic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1135073943 16:19377139-19377161 AACTCAGGACTGTACTATAAGGG + Intergenic
1135246332 16:20860361-20860383 AACTCCTTCCTGCAACAGAAAGG + Exonic
1137784947 16:51130844-51130866 AAAACCATTCTGCACTATAAGGG + Intergenic
1139719531 16:68841323-68841345 ATCTCCATCCTGCACCATGAAGG - Intergenic
1143223264 17:5280118-5280140 ACCTCTGTCCTGCACCATGAGGG + Intergenic
1143690054 17:8554346-8554368 CACTCTATCCAGCACTATAATGG + Intronic
1147875402 17:43617240-43617262 AGCTCCGTCCTGCACAGCAAGGG - Intergenic
1156203393 18:34859111-34859133 CACACCTTCCTGTACTATAAAGG + Intronic
932555951 2:72825422-72825444 AACTACGTCCTGCCCTAGACAGG - Intronic
936808799 2:116371110-116371132 AACTCAGTCCTGAACTATACTGG - Intergenic
945739519 2:213643282-213643304 CACTCCCTCCTGGCCTATAAAGG + Intronic
947944049 2:234084315-234084337 AACCACGTCCTACATTATAAGGG - Intergenic
1175510107 20:59518405-59518427 AACTCCTTCCTGCACAGAAAAGG + Intergenic
1176802969 21:13450852-13450874 AAATTCTTCCTGAACTATAAAGG + Intergenic
955662306 3:61314296-61314318 AACTCTGTCCTGGGCTATGATGG - Intergenic
957000877 3:74883286-74883308 AGCTCTGTCCTGCACCATGAAGG + Intergenic
971860554 4:32097625-32097647 TACTCCAACCTGCACTGTAAAGG + Intergenic
991297074 5:65092960-65092982 AACTCAGTGCTGCCCTATTATGG + Intergenic
992033797 5:72751306-72751328 AACTCTGTGCAGTACTATAATGG + Intergenic
1000022023 5:157326486-157326508 AACTCTGTGCTGCACCATGAAGG + Intronic
1009375266 6:62960857-62960879 CACTCTCTCCTGCCCTATAATGG + Intergenic
1011701208 6:89956660-89956682 AACTCTGTCCTGCAGCAAAATGG - Intronic
1024744014 7:52386800-52386822 CACTCAGTACTGCTCTATAAGGG + Intergenic
1027006779 7:74701112-74701134 AACTCTTTCCTGAACTATAAAGG - Intronic
1028329591 7:89572767-89572789 AACACCTTCCTGAACTAAAAAGG - Intergenic
1028749511 7:94367070-94367092 ATCTCCGGCCTGCGCTATGACGG + Intergenic
1030264694 7:107607668-107607690 CACTCCAGCCTGCACTACAAAGG - Intronic
1040044334 8:42946568-42946590 AAATCTGTTTTGCACTATAAGGG - Intronic
1046522732 8:115346075-115346097 CACTCCAGCCTGCACTACAAAGG + Intergenic
1047483750 8:125309212-125309234 AACTCCAGCCTGGGCTATAAGGG + Intronic
1053715400 9:40883739-40883761 GACTCCGTCCTGCAAGATGAAGG + Intergenic
1054077148 9:60546995-60547017 GACTCCGTCCTGCAAGATGAAGG - Intergenic
1055185906 9:73453708-73453730 AATTCAGTCCAGCAATATAAAGG - Intergenic
1187035740 X:15537622-15537644 AACTCCGTCCTGCACTATAAGGG + Intronic
1188582276 X:31728740-31728762 TCCTCCTTCCTGCACTACAAAGG + Intronic
1193699741 X:84746277-84746299 AACTCCTTCCTGCATAATTAAGG - Intergenic
1195821290 X:108947424-108947446 AACTCAGTGCTGCCCTATTATGG - Intergenic
1198079750 X:133228085-133228107 AACTCCATCTTGTACTATGAGGG - Intergenic