ID: 1187037194

View in Genome Browser
Species Human (GRCh38)
Location X:15553157-15553179
Sequence CAGTGTAGTTAGTTGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187037192_1187037194 9 Left 1187037192 X:15553125-15553147 CCTGGATAAATAAAAGCTTTGGA 0: 1
1: 0
2: 0
3: 23
4: 259
Right 1187037194 X:15553157-15553179 CAGTGTAGTTAGTTGGATTTTGG 0: 1
1: 0
2: 0
3: 7
4: 152
1187037190_1187037194 24 Left 1187037190 X:15553110-15553132 CCAGGTTTCAGAGGACCTGGATA 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1187037194 X:15553157-15553179 CAGTGTAGTTAGTTGGATTTTGG 0: 1
1: 0
2: 0
3: 7
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187037194 Original CRISPR CAGTGTAGTTAGTTGGATTT TGG Intronic
903346100 1:22685279-22685301 CAGTCTCTTTTGTTGGATTTGGG - Intergenic
911060480 1:93743725-93743747 CAGTGTACTTAGTTGTAGCTGGG - Intronic
911940661 1:104043323-104043345 CTGTCTGGTTAGTTGCATTTGGG + Intergenic
912392369 1:109312737-109312759 GAATGTAGTTGGGTGGATTTTGG - Exonic
914426885 1:147586008-147586030 CACTGTAGTTAGTGGGATACAGG - Intronic
918148416 1:181778137-181778159 CATTCTAGTTAGTTAGAGTTTGG + Intronic
918462230 1:184788612-184788634 CAGGGTAGGCAGCTGGATTTTGG + Intergenic
919705773 1:200673830-200673852 CAGTGTAGTCTAGTGGATTTAGG - Intergenic
920020500 1:202952266-202952288 CAATGTGGTTATTTGGGTTTGGG - Intronic
924561655 1:245161609-245161631 CAGTGTAGTTCGTGGTATGTAGG - Intronic
1064740976 10:18434386-18434408 CAGTGTAGCCAGTAGAATTTGGG + Intronic
1066143743 10:32534988-32535010 CAGTGTAGAAACTTGGAGTTGGG + Intronic
1066329397 10:34403144-34403166 CATTTTACTTAGTTGCATTTGGG - Intronic
1067224119 10:44364207-44364229 CATTGGAGTGAGATGGATTTGGG + Intergenic
1070288437 10:75099946-75099968 CAGTGTAGTGTGGTGGAGTTGGG + Intronic
1074028375 10:109660600-109660622 CAGTGTGGTTGGTATGATTTTGG + Intergenic
1074246855 10:111702982-111703004 CATTGCAATTAGTTGGAATTAGG - Intergenic
1075018456 10:118928725-118928747 CCGTGTAGTTTCTTGGATTCTGG - Intergenic
1079295670 11:19231376-19231398 CAGTGGAGTTACTGTGATTTTGG - Intronic
1079893886 11:26094211-26094233 CAGAGTAGTTAGGGGGATTTTGG - Intergenic
1080862669 11:36163490-36163512 CAGTGTAGGTAAATAGATTTCGG + Intronic
1083366459 11:62144410-62144432 CAGTCTAGTGAGATGGATTAGGG - Intronic
1085872361 11:80365622-80365644 CAGTGTAGCTAGTTAGCCTTCGG + Intergenic
1086740867 11:90367288-90367310 CAGTGTAGTTATTTCTACTTGGG + Intergenic
1087558277 11:99750638-99750660 CAGTATATTTAGTTAGATTCTGG - Intronic
1090158871 11:124470516-124470538 CAGTGTTGTCAGTGGGATGTAGG + Intergenic
1090468558 11:126957586-126957608 CAGTCTAGTGAGTTGGACTATGG + Intronic
1090520714 11:127476030-127476052 CAGTGTAGCTAGTCGAAGTTGGG + Intergenic
1093658920 12:21731158-21731180 AACTGTAGGTAGTTGGAATTAGG - Intronic
1094290064 12:28837797-28837819 CAGTGTGGTTGGTATGATTTGGG - Intergenic
1095546093 12:43372079-43372101 CTGAGTAGACAGTTGGATTTTGG + Intronic
1096711930 12:53464058-53464080 CAGTCTAGTTAGTCAGAGTTGGG + Intronic
1098437870 12:70487127-70487149 CAGTGTAGAAAGTTGTATTTTGG - Intergenic
1101411268 12:104470455-104470477 AAGTGGAGTTAGTTGGATCATGG - Intronic
1102655350 12:114478425-114478447 CAGTGTAGTTAGTTCATTCTGGG + Intergenic
1103186048 12:118958402-118958424 CAGTGAAGCAAGATGGATTTAGG + Intergenic
1103341083 12:120221534-120221556 CAGTGTGGGTAGCTGGATCTTGG - Intronic
1104575674 12:129963862-129963884 CATTGTCTTTGGTTGGATTTGGG - Intergenic
1105400997 13:20096008-20096030 AAGAGTAGTCAGTGGGATTTGGG - Intergenic
1106150252 13:27093501-27093523 TGGTGTTGTCAGTTGGATTTTGG - Intronic
1107371263 13:39751915-39751937 ATGTGTAGTTGGTTGGATTTAGG - Exonic
1107895914 13:44963122-44963144 GACTGTAATTAATTGGATTTGGG + Intronic
1109285687 13:60405653-60405675 CAGTGTAGTGAGATGGAATTAGG + Intronic
1110342237 13:74405473-74405495 AAGTGTACTTAGTTCCATTTTGG + Intergenic
1110530487 13:76591656-76591678 AAGTGTAGTTTGATGAATTTTGG - Intergenic
1111036818 13:82685148-82685170 AAGTGGAGGTAATTGGATTTTGG + Intergenic
1112382820 13:98909081-98909103 CAGAGTAGTCAGTGGGCTTTGGG - Intronic
1116145336 14:41060678-41060700 CAGTGTTGTTATGTTGATTTGGG - Intergenic
1117831774 14:59758541-59758563 CAGAGATGTTATTTGGATTTGGG - Intronic
1124413756 15:29457833-29457855 CAGTGTTCTTATTTGGAATTTGG - Intronic
1124607071 15:31177624-31177646 GAGTGTAGGTACTTGGATATAGG - Intergenic
1124710938 15:32010310-32010332 AAGTGTAATTATTTGGATATTGG - Intergenic
1125518575 15:40336197-40336219 CAGAGGAAATAGTTGGATTTAGG - Intronic
1125984410 15:44035903-44035925 CATTCTAGTTAGTTGGCTTCAGG - Intronic
1127529747 15:59832113-59832135 GATTGTAATTAATTGGATTTTGG - Intergenic
1127602461 15:60551979-60552001 CAGTGTAGGTGGTTGAACTTCGG + Intronic
1128051442 15:64668276-64668298 CAGAGTTTTTAGTTGTATTTAGG - Intronic
1129480997 15:75826186-75826208 CAGTGTATTTACTTGCATTCTGG + Intergenic
1130414585 15:83680355-83680377 CAGGGTGTTTAGTTGTATTTGGG + Intronic
1131578644 15:93617980-93618002 CAGTGTATTTAGTTGTACTTAGG + Intergenic
1143899247 17:10161310-10161332 CACTGTAGTGAGAGGGATTTAGG + Intronic
1144086794 17:11816656-11816678 TGGTTTAGTTAGTTGGACTTTGG - Intronic
1147417967 17:40307340-40307362 CAGTGAAGTCAGCTGGATTGAGG - Intergenic
1147496321 17:40919582-40919604 CGGTTTGTTTAGTTGGATTTTGG + Intergenic
1149261063 17:54879921-54879943 CATTGTGATTGGTTGGATTTGGG - Intergenic
1155015391 18:21833595-21833617 CAGTTTAGCTAGTAGGGTTTGGG + Intronic
1156424957 18:36999898-36999920 CATTGTGGTTTGGTGGATTTCGG - Intronic
1158491010 18:57909764-57909786 CAGTGCAGTTAATTGGTGTTCGG + Intergenic
1164184704 19:22854407-22854429 CAGGAAAGTAAGTTGGATTTTGG + Intergenic
1164550055 19:29202822-29202844 AAGTGTAGTTTATTGAATTTAGG + Intergenic
1168390609 19:56004329-56004351 CATTGAAGTTAATAGGATTTGGG + Intronic
927071262 2:19531886-19531908 CTGAGTAGTTGGTTGAATTTTGG - Intergenic
930194614 2:48496762-48496784 CAGTGGAGCTTGTTGGATTTAGG + Intronic
932866728 2:75351250-75351272 CAGTCTAGTTAGTTTGGATTTGG - Intergenic
934169459 2:89327554-89327576 CAAGGTAGTTAGTTATATTTTGG - Intergenic
934197835 2:89855031-89855053 CAAGGTAGTTAGTTATATTTTGG + Intergenic
935175726 2:100647254-100647276 CAGTGGAGTTTTTTGGTTTTGGG - Intergenic
935728048 2:106040904-106040926 CTGTGTAGTTGGATGGCTTTGGG - Intergenic
936804497 2:116312176-116312198 CAGTGTTTTTAGTTGAAATTAGG + Intergenic
937615571 2:123918111-123918133 CAGTTTAGTTATTTTGACTTTGG + Intergenic
937762311 2:125620733-125620755 TAATTTAGTTAGTTGGTTTTGGG + Intergenic
939293278 2:140222530-140222552 CAGTATTGTGAGTAGGATTTAGG + Intergenic
943155899 2:184176402-184176424 CACTGTAATTTGTAGGATTTTGG + Intergenic
944788937 2:203103963-203103985 GAGTGTAGTTGGTATGATTTTGG + Intronic
1170390119 20:15863425-15863447 ATGTGCCGTTAGTTGGATTTGGG + Intronic
1170467114 20:16632199-16632221 GAGTGTATTAAGTTGGATATTGG - Intergenic
1171039178 20:21743840-21743862 CATTGTATTTAGTTATATTTTGG + Intergenic
1176937424 21:14883250-14883272 CAGTGTAGCTAGATGGTTCTGGG + Intergenic
1177500256 21:21945329-21945351 CAGTGAAGTTATTGGCATTTTGG - Intergenic
1178011619 21:28293273-28293295 CAGTATATTTGTTTGGATTTAGG - Intergenic
949454984 3:4228696-4228718 CAGTGTGGTTTTTAGGATTTGGG - Intronic
949550214 3:5106394-5106416 CTCTCTAGTTAGTTGGATCTGGG - Intergenic
950352451 3:12369643-12369665 CAATGTAGTTACTTGTAATTTGG + Intronic
951763739 3:26173532-26173554 CAGTGTAATTTGTGAGATTTTGG + Intergenic
952916402 3:38247991-38248013 CAGTGTAGCTAGTTTGGGTTAGG + Intronic
955962532 3:64355574-64355596 CAGTGTTGTTACTTGGAAGTAGG - Intronic
959881642 3:111450118-111450140 GAGTGTGGTTAGTATGATTTTGG - Intronic
960714792 3:120564265-120564287 CAGTGAAAATAATTGGATTTGGG + Intergenic
964404088 3:156330408-156330430 CAGTGTAGATACCTGGATTGTGG - Intronic
965277897 3:166710862-166710884 AAGTGCTGTTAGTTTGATTTAGG - Intergenic
965973576 3:174593014-174593036 CTGATTGGTTAGTTGGATTTAGG - Intronic
971469530 4:27006410-27006432 CAGTGTCCTTAGTTAGCTTTGGG + Intronic
974068285 4:57100897-57100919 CAGTGTCTTTATTTGGAATTTGG + Intronic
974842596 4:67315446-67315468 CACTGTAGAGATTTGGATTTAGG + Intergenic
976522405 4:86043938-86043960 CATTGTATTCAGTTAGATTTGGG - Intronic
977394297 4:96452148-96452170 GAGTGTGGTTAGTAAGATTTTGG + Intergenic
979859053 4:125670904-125670926 AAATGAAGTTAGTTGGAGTTCGG - Intergenic
981094130 4:140761024-140761046 AAGTGTAGTTAGTTAGTCTTTGG + Intergenic
982175753 4:152704266-152704288 GAATGGAGTTAGCTGGATTTGGG - Intronic
983444523 4:167833065-167833087 CAGTGAAGACAGTTGGCTTTGGG + Intergenic
986767815 5:10943708-10943730 AAGTGAAGTTTGTAGGATTTGGG - Intergenic
987883666 5:23783435-23783457 AAGTCTAGTTAGCTTGATTTTGG + Intergenic
988951308 5:36264487-36264509 CAGTGTAGTTGGGAGGGTTTGGG - Intronic
989368413 5:40680684-40680706 CAATGGAGTGAGTTGGATTGTGG + Intronic
990748353 5:58983889-58983911 TAGTGGACTTAGTTGGATTTGGG - Intronic
992601282 5:78403267-78403289 CAGTATAGTTATTTGTATGTAGG - Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
997333752 5:133088178-133088200 AAGGGTAGCTAGTGGGATTTAGG - Intronic
997799441 5:136844993-136845015 CTGTGAACTTATTTGGATTTAGG + Intergenic
998249216 5:140539050-140539072 CAGTGCATTCAGTTGAATTTTGG - Exonic
1003780406 6:9418139-9418161 AAGTGTAGTCATTTGGACTTAGG + Intergenic
1011136630 6:84107257-84107279 TAGTGGACCTAGTTGGATTTTGG - Intergenic
1012657723 6:101846625-101846647 CAGTGAAGTTATTTGGTTCTGGG + Intronic
1016009900 6:139128606-139128628 CAGTGTAGTTAGTTCATTGTTGG - Intergenic
1021369875 7:19831325-19831347 CACTGTAGTTCTTTGGATCTTGG - Intergenic
1021393266 7:20120605-20120627 CAGTGAATTTTGTTGTATTTGGG + Intergenic
1022545489 7:31184264-31184286 GAGTGTAGTTGGTAAGATTTTGG + Intergenic
1023785430 7:43703197-43703219 CAGTGTGGTTAGCATGATTTCGG + Intronic
1026123216 7:67555806-67555828 CAGTGCTGTTATTTGGATTCAGG - Intergenic
1026228636 7:68464332-68464354 CCATGTAGTTAGTTGGCTGTGGG - Intergenic
1030942830 7:115676465-115676487 CAATGCAATTATTTGGATTTGGG + Intergenic
1031184991 7:118465837-118465859 CAGTGTAATAAATTGTATTTTGG - Intergenic
1033674771 7:143529803-143529825 CACTGCAGTGAGTTGAATTTGGG + Intergenic
1043810939 8:84739672-84739694 CAATGTAGTTAGATGTAGTTAGG + Intronic
1044806132 8:96010293-96010315 CAGTTTTGTTCGTAGGATTTAGG - Intergenic
1045748279 8:105450831-105450853 TAGTGTAGTTAAGTGGATATCGG + Intronic
1048440691 8:134457283-134457305 CATTGTAGCTCGTTTGATTTTGG - Intergenic
1050937086 9:11412934-11412956 CAGTGCAGTTAGTTTGACTAAGG - Intergenic
1050972651 9:11896532-11896554 GAGTGTAGTTGGTATGATTTTGG + Intergenic
1051464858 9:17366094-17366116 AATTGTAGTTTTTTGGATTTGGG + Intronic
1057954847 9:99399453-99399475 AAGTGGAGTCAGTTGGATCTGGG - Intergenic
1058916434 9:109570769-109570791 GAGTGTAGTTGGTATGATTTTGG - Intergenic
1060659625 9:125397003-125397025 GTGTGCAGTTAGTTGGCTTTAGG + Intergenic
1061685077 9:132269413-132269435 CAGTGTAGATACTTGGGTTCTGG + Intronic
1186859860 X:13661883-13661905 CAGTGTAGCCTGTTGGCTTTTGG + Intronic
1187037194 X:15553157-15553179 CAGTGTAGTTAGTTGGATTTTGG + Intronic
1187281778 X:17862882-17862904 CTGTGTCTTTAGTTGGATTCAGG - Intergenic
1191032949 X:55994778-55994800 GAGTGTAGTTGGTATGATTTTGG + Intergenic
1192791465 X:74386090-74386112 CTGTGTAATAGGTTGGATTTAGG - Intergenic
1192876077 X:75230804-75230826 CAGTGTGGCTACTGGGATTTAGG - Intergenic
1194279726 X:91934707-91934729 CAGTAAAGTTAGTAGCATTTTGG - Intronic
1195586377 X:106569584-106569606 GAGTGTAGTTGGTATGATTTTGG - Intergenic
1195971803 X:110481345-110481367 CAATGTAGTTAGTTGGCAGTGGG + Intergenic
1196170191 X:112578997-112579019 CACTGTGGTTGGTTGGAGTTTGG - Intergenic
1196387044 X:115167866-115167888 CAGTGCAGTCAGATGAATTTTGG - Intronic
1197985961 X:132266614-132266636 CAGTGTAGTTAGATGGCAGTTGG - Intergenic
1198735111 X:139776306-139776328 CTGTGTAGGGAGTTGGAGTTGGG - Intronic
1199840652 X:151644225-151644247 CAGTGTAGTTATTTTGTATTCGG + Intronic
1200561787 Y:4713028-4713050 AAGTGTATTTTGTTGGTTTTTGG + Intergenic
1200597202 Y:5158188-5158210 CAGTAAAGTTAGTAGCATTTTGG - Intronic