ID: 1187045669

View in Genome Browser
Species Human (GRCh38)
Location X:15646232-15646254
Sequence CTTGGTGGCCAGACCGTACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187045661_1187045669 2 Left 1187045661 X:15646207-15646229 CCGTGGCCTCCTGCCCCATGCAA 0: 2
1: 0
2: 3
3: 48
4: 457
Right 1187045669 X:15646232-15646254 CTTGGTGGCCAGACCGTACCCGG 0: 1
1: 0
2: 1
3: 0
4: 71
1187045660_1187045669 7 Left 1187045660 X:15646202-15646224 CCTGGCCGTGGCCTCCTGCCCCA 0: 2
1: 0
2: 4
3: 58
4: 489
Right 1187045669 X:15646232-15646254 CTTGGTGGCCAGACCGTACCCGG 0: 1
1: 0
2: 1
3: 0
4: 71
1187045664_1187045669 -7 Left 1187045664 X:15646216-15646238 CCTGCCCCATGCAACACTTGGTG 0: 1
1: 1
2: 1
3: 8
4: 126
Right 1187045669 X:15646232-15646254 CTTGGTGGCCAGACCGTACCCGG 0: 1
1: 0
2: 1
3: 0
4: 71
1187045662_1187045669 -4 Left 1187045662 X:15646213-15646235 CCTCCTGCCCCATGCAACACTTG 0: 1
1: 1
2: 4
3: 19
4: 249
Right 1187045669 X:15646232-15646254 CTTGGTGGCCAGACCGTACCCGG 0: 1
1: 0
2: 1
3: 0
4: 71
1187045658_1187045669 21 Left 1187045658 X:15646188-15646210 CCGCAAAGCTCTGGCCTGGCCGT 0: 1
1: 0
2: 3
3: 16
4: 153
Right 1187045669 X:15646232-15646254 CTTGGTGGCCAGACCGTACCCGG 0: 1
1: 0
2: 1
3: 0
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187045669 Original CRISPR CTTGGTGGCCAGACCGTACC CGG Intronic
901532217 1:9860751-9860773 CTTGCTGGCCAGAACTTCCCAGG + Intronic
902286170 1:15409976-15409998 CTTGGTGGCCAGCTCGTCCGTGG - Exonic
905169141 1:36099268-36099290 CCTGGTGGCCCGACCTTGCCAGG + Exonic
906970620 1:50509728-50509750 CTTGGTGGCCGAACAGTACAGGG + Intronic
912799541 1:112712421-112712443 CTTGGTGGCCACGCCGCTCCCGG + Exonic
920980730 1:210832222-210832244 CTTTTTGGTCAGACCTTACCAGG - Intronic
922613479 1:226946499-226946521 CTTGCTGGCCAGGCCAGACCAGG + Intronic
922945153 1:229508033-229508055 GTTGGTTGCCAGACCCAACCAGG + Intronic
1066657357 10:37708605-37708627 CTTGGTGGCCTGCCCCTCCCAGG - Intergenic
1067041834 10:42958227-42958249 CTTGGTGGCCTGCCCCTCCCAGG - Intergenic
1073513904 10:104060473-104060495 CTTGGTGGCCAGGCCCAGCCAGG - Intronic
1078248945 11:9601498-9601520 TTTGGTGTCCAGACAGCACCAGG + Intergenic
1081712496 11:45226425-45226447 CTTGGAGGGCAGGCCCTACCTGG + Intronic
1084470348 11:69355858-69355880 ATTGGTGGCCTGACAGTGCCAGG + Intronic
1086350511 11:85939005-85939027 ATTGGTGGCAAGACTGTAACTGG + Intergenic
1086374282 11:86184559-86184581 CTTGGTGGCCTCACAGTACATGG - Intergenic
1089500435 11:118928789-118928811 CTTGGTGGCGACACCGTCCTGGG + Intronic
1098309376 12:69133069-69133091 CTTGGTGGCCAGATAGCAGCTGG + Intergenic
1113951258 13:114072257-114072279 CTAAGTGGCCAGGCCGTACTCGG - Intronic
1116825466 14:49669270-49669292 CTTGGAGGCCAGAGTGTATCTGG + Intronic
1128785489 15:70393897-70393919 TTTGGTGACCTGACCGTACTTGG - Intergenic
1129466514 15:75727248-75727270 CCTGGAGGCCAGACTGTAGCAGG - Exonic
1138346290 16:56322306-56322328 CTTGCTGGTCAGAGCGTGCCTGG - Intronic
1150353954 17:64467464-64467486 CTGGGTGGCCTGACAGAACCAGG - Intronic
1151478725 17:74357662-74357684 CTTGGTGGCCAGTCTGTGCAGGG + Exonic
1152718754 17:81912222-81912244 CTCGATGGCCAGGCCGTATCAGG + Exonic
1156004042 18:32419264-32419286 CTTGGTGGCCCGACCTAATCAGG - Intronic
1157764396 18:50286021-50286043 CTTGGTGGCCACACCCAGCCAGG - Exonic
1165349312 19:35267750-35267772 CCTGGCGTCCAGACCGTCCCTGG + Intronic
1168195427 19:54770748-54770770 CTTGGTAGCCAGGCCCTTCCTGG - Intronic
935091678 2:99900689-99900711 CTGGGTGGCCAGACCAGGCCTGG + Intronic
937114792 2:119397408-119397430 CTTGCTGGCCTGACCTTGCCTGG - Intergenic
947149671 2:227102354-227102376 CATGGAGGCCAGACCGCAGCTGG - Intronic
1169580174 20:7013453-7013475 TTTGGTGGCCAGTCTGTAACAGG + Intergenic
1171012881 20:21518009-21518031 CTTGGGTGCAAGACGGTACCTGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176220543 20:63967487-63967509 CGTGGTGGACAGACAGTGCCCGG - Exonic
1176672004 21:9744187-9744209 TTTGGTGGCCTCACCATACCTGG - Intergenic
1178523340 21:33304093-33304115 CTTGGTGACCAGCCAGTAGCAGG + Intergenic
1180800415 22:18629239-18629261 CAGGATGGCCAGACCGCACCTGG + Intergenic
1180851649 22:19024795-19024817 CAGGATGGCCAGACCGCACCTGG + Intergenic
1181221304 22:21366023-21366045 CAGGATGGCCAGACCGCACCTGG - Intergenic
952258292 3:31714311-31714333 CTTGCTGGGCAGACAGTAGCTGG + Intronic
953350223 3:42209830-42209852 CTTGGTGACCACACCGGGCCGGG - Exonic
953738612 3:45517271-45517293 CCTAGTGGCCAGACAGTACAAGG + Intronic
955395747 3:58555954-58555976 CTTGCTGACCAGACCCTTCCAGG - Intergenic
956202233 3:66718609-66718631 CTTGATGCCCAGACCACACCCGG + Intergenic
962426104 3:135270693-135270715 CTTGATGACCAGACCCTGCCTGG + Intergenic
962895949 3:139714995-139715017 CTTGGTGGCTAGACCAGGCCAGG + Intergenic
978732802 4:112049899-112049921 CATGGTGGCCAGGCTGGACCTGG - Intergenic
985402731 4:189607636-189607658 TTTGGTGGCCTCACCATACCTGG + Intergenic
986178183 5:5369637-5369659 TTTGGTGGCCAGACTTTAGCAGG + Intergenic
989493832 5:42088588-42088610 CTTTGTGTCCACACAGTACCAGG - Intergenic
992073696 5:73172173-73172195 CATGGTGGCCACACAGTTCCTGG - Intergenic
993721062 5:91322409-91322431 CATGGTGGCCAGGCCTGACCTGG + Intergenic
1000976620 5:167771974-167771996 TATGGTGGCCATACAGTACCTGG + Intronic
1003752656 6:9078560-9078582 GTTGGTGGCCAGATAATACCAGG - Intergenic
1009850244 6:69187844-69187866 CTTGGTGACCAGACAATGCCTGG - Intronic
1014517687 6:122399827-122399849 CGCCGTGGCCTGACCGTACCTGG - Exonic
1018455027 6:163944157-163944179 CTTGGTGGCCTGTCAGTACATGG - Intergenic
1020326670 7:6979594-6979616 CTGGGTGGCCACCCCGTCCCAGG - Intergenic
1032115230 7:129111121-129111143 CCTGGTGGCCTGCCCCTACCTGG + Intergenic
1032201635 7:129826218-129826240 CTGGGTGGCCAGGCCGGAGCTGG - Intergenic
1032674001 7:134111344-134111366 GTTGGTGCCCAGAACTTACCTGG - Intergenic
1037457082 8:19074185-19074207 TTTGCTGGTCAGACCGTACTGGG - Intronic
1037753085 8:21695351-21695373 TTTGGTGGCCAGAACTTCCCTGG - Intronic
1039568276 8:38566161-38566183 CCTGGTGGACTGACCGAACCAGG + Intergenic
1061163501 9:128909597-128909619 CTTGGGGGACAGACCTTGCCTGG - Intronic
1062206428 9:135339941-135339963 CTTGGTAGCCAGCCCTCACCCGG - Intergenic
1062287680 9:135780371-135780393 GTTGGTGGCCAGGCCGGGCCTGG - Intronic
1187045669 X:15646232-15646254 CTTGGTGGCCAGACCGTACCCGG + Intronic
1187051701 X:15702669-15702691 GTTGGTGGACAGACCGTACCTGG + Intronic
1198802367 X:140460717-140460739 CTGGGTGATCAGACTGTACCTGG - Intergenic