ID: 1187052706

View in Genome Browser
Species Human (GRCh38)
Location X:15710284-15710306
Sequence GTGACTGTGAAATGAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 291}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187052698_1187052706 19 Left 1187052698 X:15710242-15710264 CCCTGTATTCCTGAAGCTTGGCC 0: 1
1: 0
2: 4
3: 19
4: 121
Right 1187052706 X:15710284-15710306 GTGACTGTGAAATGAGTGGATGG 0: 1
1: 0
2: 1
3: 31
4: 291
1187052702_1187052706 10 Left 1187052702 X:15710251-15710273 CCTGAAGCTTGGCCCATGTGGGT 0: 1
1: 0
2: 1
3: 15
4: 128
Right 1187052706 X:15710284-15710306 GTGACTGTGAAATGAGTGGATGG 0: 1
1: 0
2: 1
3: 31
4: 291
1187052703_1187052706 -2 Left 1187052703 X:15710263-15710285 CCCATGTGGGTCACTCAGTAAGT 0: 1
1: 0
2: 0
3: 0
4: 101
Right 1187052706 X:15710284-15710306 GTGACTGTGAAATGAGTGGATGG 0: 1
1: 0
2: 1
3: 31
4: 291
1187052704_1187052706 -3 Left 1187052704 X:15710264-15710286 CCATGTGGGTCACTCAGTAAGTG 0: 1
1: 0
2: 4
3: 41
4: 232
Right 1187052706 X:15710284-15710306 GTGACTGTGAAATGAGTGGATGG 0: 1
1: 0
2: 1
3: 31
4: 291
1187052697_1187052706 20 Left 1187052697 X:15710241-15710263 CCCCTGTATTCCTGAAGCTTGGC 0: 1
1: 0
2: 4
3: 12
4: 154
Right 1187052706 X:15710284-15710306 GTGACTGTGAAATGAGTGGATGG 0: 1
1: 0
2: 1
3: 31
4: 291
1187052699_1187052706 18 Left 1187052699 X:15710243-15710265 CCTGTATTCCTGAAGCTTGGCCC 0: 1
1: 1
2: 0
3: 7
4: 112
Right 1187052706 X:15710284-15710306 GTGACTGTGAAATGAGTGGATGG 0: 1
1: 0
2: 1
3: 31
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187052706 Original CRISPR GTGACTGTGAAATGAGTGGA TGG Intronic
900327866 1:2118747-2118769 GTGTGTGTGAGATGAGGGGAGGG + Intronic
900518060 1:3092569-3092591 GCGAGTGGGAAATGAGTGGGAGG + Intronic
901177300 1:7313810-7313832 GTGCCTGTGAAAAGGCTGGAAGG + Intronic
901343756 1:8519714-8519736 CTGACTGTGATATGGGTGGAAGG - Intronic
905460604 1:38120469-38120491 GTGTCTGTGGAAGGAGTGGTTGG - Intergenic
905725328 1:40246463-40246485 GTGACTGACAGATGAGTGGGTGG + Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
907291253 1:53414318-53414340 GTAAATGTTAAATGAGTGAATGG + Intergenic
908626863 1:66054375-66054397 GTGACTGTTACATGGGTGTATGG - Intronic
908880150 1:68722907-68722929 GTGACTTTGAATAGAGTGGGAGG - Intergenic
909836192 1:80258582-80258604 ATGACTGATAGATGAGTGGAGGG - Intergenic
911400776 1:97372251-97372273 CAGACTGTGAAACAAGTGGAGGG + Intronic
911617199 1:100027648-100027670 GTGACTGTCAATTGAATGCATGG + Intergenic
913968781 1:143398197-143398219 GTGACAGGGAATTGAGTGGTAGG - Intergenic
914063160 1:144223796-144223818 GTGACAGGGAATTGAGTGGTAGG - Intergenic
914115990 1:144742558-144742580 GTGACAGGGAATTGAGTGGTAGG + Intergenic
915997654 1:160580552-160580574 GTGATTGTGTAATGTGTGTATGG + Intergenic
917612587 1:176703652-176703674 GTGACTGCTAAATGATGGGATGG - Intronic
917758912 1:178133855-178133877 GTGACTGTCAAATCAGGGAAGGG + Intronic
919081531 1:192872187-192872209 GTCAATGTGAAATGTGTGGTAGG - Intergenic
920016821 1:202917858-202917880 ATGTTTGTGAAATGAGTGAACGG + Intronic
922472200 1:225883247-225883269 CTATCTGTGAAATGAGTGGTTGG + Intergenic
923028996 1:230231859-230231881 GTGACTCTGAGAAGAGTGGGCGG - Intronic
923493471 1:234504962-234504984 GTGACTGTGAATAGAATGGGAGG + Intergenic
924929620 1:248717685-248717707 GTGACTTTGAATTGAATGGAAGG - Intergenic
1062928336 10:1335189-1335211 ATGTCTGTGAGATGAATGGATGG + Intronic
1063589103 10:7378607-7378629 GTGAGTGTGGGTTGAGTGGATGG + Intronic
1064155905 10:12902966-12902988 GTGAATGTGAAAAGCGTGGATGG + Intronic
1064985402 10:21204796-21204818 GTGACTGAGGAAGGAGTGGTGGG + Intergenic
1067326577 10:45274247-45274269 GTGACTTTGAATCGAGTGGGAGG - Intergenic
1068868644 10:61920605-61920627 ATGACTCTTAAATGAGTAGATGG + Intronic
1069530973 10:69219212-69219234 GTGACTGTGGGAAGAGTGCAAGG + Intergenic
1069627924 10:69879953-69879975 GGGACTGTGAAAACAGAGGAGGG - Intronic
1071689649 10:87803425-87803447 GTGACTTTGAATAGAATGGAAGG - Intronic
1072288058 10:93935679-93935701 GAGAGTGTGAAAAGGGTGGAAGG + Intronic
1072985017 10:100131759-100131781 GTCAGTGTGAAGTGCGTGGATGG + Intergenic
1074772790 10:116744243-116744265 GTGGTGGTGAAATGAGAGGACGG - Intergenic
1075176397 10:120165921-120165943 GGGACTGAGGAATCAGTGGAAGG - Intergenic
1079348817 11:19675615-19675637 CTGACTGAGAAATGTGTGGTAGG + Intronic
1082012700 11:47461012-47461034 GTGACTGCTAAATGAGTACAGGG + Intergenic
1083392960 11:62368475-62368497 GATACTGTGAAATGATTGAAGGG + Intronic
1083579138 11:63813729-63813751 GTGACGCTGAAATGCGAGGAAGG + Exonic
1084713120 11:70856486-70856508 GTGAATGGATAATGAGTGGATGG + Intronic
1085240486 11:75050029-75050051 GTGACTTTGAATAGAATGGAAGG - Intergenic
1086064435 11:82731787-82731809 GGGACTGTGATAAGGGTGGAGGG + Exonic
1088416380 11:109593930-109593952 GTGACTGTGAAAAGATAGGAAGG + Intergenic
1088640030 11:111863507-111863529 TTGACTGTGAGTGGAGTGGAGGG - Intronic
1089821655 11:121233770-121233792 GTAACTGAGAAATGAGGGAATGG + Intergenic
1090956032 11:131513482-131513504 GAGCCTGTGACATGAGGGGAAGG + Intronic
1091714769 12:2768853-2768875 GCTACTGTGAACTGATTGGATGG + Intergenic
1091768065 12:3134761-3134783 GTGACTGTGAGCTGAGAGCAGGG + Intronic
1092314717 12:7398313-7398335 GGGACTGTGAACACAGTGGATGG - Exonic
1093749230 12:22779540-22779562 GTGACTGTCAAAGGGATGGATGG + Intergenic
1094479599 12:30871186-30871208 GTGAATGGGAGATGAGTGAATGG - Intergenic
1095512650 12:42969908-42969930 GTTTCCGTAAAATGAGTGGAAGG + Intergenic
1095890749 12:47233524-47233546 GTGACTGGGAAATAAATGGGGGG + Intronic
1096412052 12:51384067-51384089 GCGAGAGGGAAATGAGTGGATGG - Intronic
1097368476 12:58746231-58746253 GTGAGTATGAAGTGAGAGGAGGG + Intronic
1097777806 12:63668531-63668553 GCGACTGTGAAATGTGGGGTGGG + Exonic
1098606336 12:72395351-72395373 ATGACTGTGAACTGAATGGGGGG - Intronic
1098864553 12:75747061-75747083 GTGACTTTGAATTGAATGGGAGG + Intergenic
1100190307 12:92183683-92183705 GTGCCTGTGAAATCAGAGGCAGG - Intergenic
1100562068 12:95757087-95757109 GTGAGTGAGACATGAGTGCAGGG + Intronic
1100576363 12:95895298-95895320 GTGAATATGAAATGAGATGAAGG + Intronic
1101198881 12:102414165-102414187 GTGTCTGTGCAAGGAGTGGGAGG - Intronic
1101827044 12:108228537-108228559 GTGACTGGGAAATGAGAAGGAGG - Intronic
1102035318 12:109767912-109767934 ATGAATGGGAAATGAGTGGAGGG + Intronic
1102329751 12:112019005-112019027 GTGACTGCGTAATGAGTATAGGG + Intronic
1102731743 12:115117408-115117430 GTGACTTTGAATAGAATGGAAGG + Intergenic
1103252130 12:119508991-119509013 GAGACTTTGCAATGAGGGGAGGG + Intronic
1104092116 12:125526017-125526039 GTGACTGTGTAAGGAGTGGGAGG + Intronic
1104321594 12:127756604-127756626 GTGACTTTGAATTGAATGGGAGG - Intergenic
1104433532 12:128736767-128736789 GTGACTGTTGACTTAGTGGATGG + Intergenic
1104809349 12:131611188-131611210 GTGCCTGTGGAATGAGGGCATGG + Intergenic
1106822204 13:33477747-33477769 ATGACTGAGAAATGAGGAGAAGG + Intergenic
1106851509 13:33798146-33798168 CTGAGTGTGACATGAGTGTAGGG - Intergenic
1107764804 13:43722776-43722798 TTGACTTTGAATTCAGTGGAAGG - Intronic
1108674971 13:52728683-52728705 CTGAATGTGAGATGTGTGGAGGG + Intronic
1109501939 13:63249326-63249348 GTGAAGGTGAAAGGAATGGAAGG + Intergenic
1111565644 13:90011606-90011628 CTGACTTTGTAATAAGTGGATGG - Intergenic
1112901942 13:104367522-104367544 TTGACTGTTTAATGAATGGACGG - Intergenic
1113806499 13:113113040-113113062 GTGAGTGTGAGATGAGTGTAAGG - Intronic
1114216664 14:20662321-20662343 CAGACTTTGAACTGAGTGGAAGG + Intergenic
1114689475 14:24566803-24566825 GAGACTGTGACTTCAGTGGATGG + Intergenic
1116646946 14:47540312-47540334 GTCACTTTAAAATAAGTGGATGG - Intronic
1117819056 14:59629798-59629820 GTATCTGTGAAATAAATGGAGGG - Intronic
1119190928 14:72681209-72681231 ATGACTAGGAATTGAGTGGACGG + Intronic
1120378122 14:83735272-83735294 GAGACTGGGAAGTGAGTGGAAGG - Intergenic
1120445420 14:84588954-84588976 GTGACTGTGAAAACAGTGACGGG + Intergenic
1121258973 14:92552675-92552697 GTGACTGTGGAATAAGTGCCTGG - Intronic
1121954287 14:98200109-98200131 GTGATAGTGAAAGGGGTGGATGG - Intergenic
1123885244 15:24719827-24719849 GTAACTGTAAAATAAATGGATGG - Intergenic
1124386197 15:29209888-29209910 CTGACTCTGAAATTAGTGGAAGG + Intronic
1124909621 15:33906179-33906201 GTGTATGTGGAATGGGTGGAGGG + Intronic
1125347829 15:38736859-38736881 GTCAGTGTAACATGAGTGGAAGG - Intergenic
1126441477 15:48694302-48694324 ATGACAGTGAAGTGAGTGGAGGG - Intergenic
1127654591 15:61044341-61044363 GTGACTCTGAGAGGAGCGGAAGG - Intronic
1128482557 15:68052908-68052930 GTGAATGTGAAGTGAGAGGTAGG + Intergenic
1128686092 15:69686847-69686869 GTGACTGTGAACAGGATGGAAGG - Intergenic
1129080413 15:73034415-73034437 CTGAGTGTGAAATGAGCAGATGG - Intergenic
1129717733 15:77862015-77862037 GGGTCTGTGAAATGGGTGGGTGG - Intergenic
1129793075 15:78354811-78354833 GTGCCTCTGAAAGGAGTGGATGG - Intergenic
1129800315 15:78408940-78408962 GTCTCTGTGCAATGAGTGGATGG - Intergenic
1133328855 16:4958801-4958823 GTGCCTGTGAAATGTGGTGAAGG + Intronic
1133737013 16:8623483-8623505 CTGCCTTTGAAATGAGTGGTAGG + Intronic
1134796118 16:17038668-17038690 GTGAGTGGGATATGAGTGGGAGG - Intergenic
1135986655 16:27189271-27189293 GAGACGGAGAAATGAGTGGATGG + Intergenic
1137566174 16:49533790-49533812 CTGACTGTGAAATGGGGAGAAGG + Intronic
1140066558 16:71616231-71616253 GTGACTCTTGAATGAATGGAGGG - Intergenic
1140921812 16:79545289-79545311 GTGTCTGTGTACTGAGTGAAAGG + Intergenic
1144966082 17:19078053-19078075 GTGAATGGGTACTGAGTGGATGG + Intergenic
1144981886 17:19174136-19174158 GTGAATGGGTACTGAGTGGATGG - Intergenic
1144986337 17:19204103-19204125 GTGAATGGGTACTGAGTGGATGG + Intergenic
1145262404 17:21362297-21362319 GTGATGGAGAAATGGGTGGATGG + Intergenic
1146230585 17:31104663-31104685 GTGACTGTGAATTAAGTTTAAGG + Intronic
1146815726 17:35940643-35940665 GTGACTGCTAAATGGGTGCAGGG - Intronic
1147515702 17:41115688-41115710 GTGACTGTGAATAGAATGGGAGG - Intergenic
1148340322 17:46869540-46869562 ATGCCTGTTGAATGAGTGGAGGG + Intronic
1148588724 17:48799517-48799539 CAGAATGTGAAATGAGGGGATGG - Intronic
1148897220 17:50845913-50845935 GTGACCCTGAAATGGGTCGAGGG - Intergenic
1150956540 17:69866407-69866429 GTGACTCTGAATAGAGTGGGAGG - Intergenic
1151096387 17:71503798-71503820 GGTACTGTGAAGTGAGTGTAGGG + Intergenic
1152558594 17:81066877-81066899 GTGACTGTGACAGCAGTGTATGG + Intronic
1153022639 18:644982-645004 TTGAGTGTGAAATTAGAGGAAGG - Exonic
1153112700 18:1611424-1611446 ATGACTTTGAAAAGAATGGAAGG - Intergenic
1155142453 18:23055322-23055344 GTGTCTGGGAAAGGGGTGGAGGG - Intergenic
1160169910 18:76544448-76544470 GAAACTGTGGAATGAGTGAATGG + Intergenic
1160226086 18:77012220-77012242 GAGACACTGAAATGAGGGGATGG - Intronic
1161093633 19:2376193-2376215 GTGGCTGTGAAGGGAGAGGAAGG - Intergenic
1161109978 19:2463556-2463578 CTGCCTGTTAAATGAGTGAATGG + Intergenic
1161591246 19:5130072-5130094 GTGCCTGTGAAGGGAGAGGAAGG - Intronic
1162062741 19:8106829-8106851 GTGGATGGGAAATGGGTGGATGG + Intronic
1162180921 19:8868077-8868099 GTGTCTGAGAGATGACTGGAAGG + Intronic
1162768856 19:12937328-12937350 GTGACTCAGAAAAGAGAGGAAGG - Intergenic
1163505226 19:17701813-17701835 GTGAGTGTGAAATGCCTGCAAGG + Intergenic
1164943342 19:32268753-32268775 GGGTTTGTGAAATGGGTGGAAGG - Intergenic
1167774714 19:51547284-51547306 ATGAGGGTGTAATGAGTGGAGGG - Intergenic
1168084591 19:54036159-54036181 GGGACTGTGTAGTGAGGGGAGGG + Intergenic
1202702570 1_KI270712v1_random:175667-175689 GTGACAGGGAATTGAGTGGTAGG - Intergenic
926093616 2:10066106-10066128 TTGCCTGTGCAATGAGTGGATGG - Intronic
926106507 2:10155520-10155542 GTTACTATGAAATGAGGGGTGGG + Intronic
927123659 2:19992854-19992876 ATGACTGTGAAATGATTGGTAGG - Exonic
927333775 2:21896724-21896746 TTGACTGTGAGAGGAGGGGAGGG + Intergenic
927608296 2:24509519-24509541 GTGACAGTGAAAAGTTTGGATGG + Intronic
927921889 2:26979007-26979029 GTCACTGTAACATGAGGGGATGG + Intronic
930013961 2:46958124-46958146 GTGACTGTGACATCTGTGGAGGG + Intronic
930036529 2:47089000-47089022 GTGGCAGTGAAATCAGGGGAGGG - Intronic
931457861 2:62426256-62426278 GTGTCTGTTAAAAGAGTGGCCGG - Intergenic
932803660 2:74764977-74764999 CTGAGTGTGAAATGAGAGGGGGG + Intergenic
934650637 2:96089560-96089582 GGGCCTGTGAAAGGACTGGAGGG - Intergenic
936539613 2:113339490-113339512 GAGACTGTGAAAATAGTGCATGG + Intergenic
937645797 2:124264853-124264875 GTGTCTGTGAAGTGTGTGCATGG + Intronic
937866976 2:126759755-126759777 GTGACTGTGAATTGGGGGAAAGG + Intergenic
938752283 2:134344128-134344150 GTGACTGATTAGTGAGTGGATGG + Intronic
940412967 2:153387997-153388019 GGAATTGTGGAATGAGTGGAAGG + Intergenic
942476762 2:176334641-176334663 ATGAATGTCAAAAGAGTGGAAGG + Intronic
943619471 2:190131855-190131877 GTGACTGTGAAAGTAGAGGTAGG + Intronic
944303740 2:198156033-198156055 GTGACTTTGAATAGAATGGAAGG - Intronic
946217081 2:218192666-218192688 GTTACTGTGTAATTAGGGGAAGG + Intergenic
946569363 2:221004758-221004780 GTGACTGCTAAATGGGTAGAGGG + Intergenic
946954879 2:224918369-224918391 GTGTCTGTGCAATGAGTGTGTGG + Intronic
946957926 2:224952365-224952387 GGGACTAAGAAATGAGTGGGAGG + Intronic
948075166 2:235160313-235160335 GTCACTGTGGGATGAGGGGAGGG - Intergenic
1168736782 20:147073-147095 GTGAGTGTGAAAGGAATGCAGGG - Intergenic
1168873008 20:1146953-1146975 GTGAAGGTGTAATGAGTAGAGGG + Intronic
1169545729 20:6648697-6648719 GTGACCATGAAAAAAGTGGAAGG + Intergenic
1169604219 20:7297524-7297546 GGAACTGTGAAAGAAGTGGAAGG - Intergenic
1172418718 20:34795739-34795761 CTGAATGTGAACTGAGTAGAAGG + Intronic
1173284923 20:41661631-41661653 GTGACTATGATATGATAGGATGG - Intergenic
1177034279 21:16022452-16022474 GTGAGTGTCTAATAAGTGGAAGG + Intergenic
1178631770 21:34267744-34267766 GTCACTGTGCAGTGAGTGTAAGG - Intergenic
1178842804 21:36151429-36151451 GTGACTTTGAATAGAATGGAAGG - Intergenic
1179643477 21:42761669-42761691 GTGAGTGTGAAATGAGCAAAAGG - Intronic
1180062014 21:45390432-45390454 CGGGCTGTGGAATGAGTGGAGGG - Intergenic
1181899572 22:26142062-26142084 GGGACTGAGAGATGGGTGGAAGG + Intergenic
1182151368 22:28029391-28029413 GTGACTGTGCACTGGGTGGGAGG - Intronic
1182827853 22:33281211-33281233 GTGGCTGTGAAATGAGTTCTCGG + Intronic
1183395851 22:37570402-37570424 GTCACTGTGAACTGTGGGGAGGG + Exonic
1184562272 22:45269930-45269952 GAGACTGTGAAAAGCGGGGAGGG - Intergenic
1184627610 22:45749366-45749388 GTGACGGTGGAAGCAGTGGATGG - Intronic
1184722236 22:46321628-46321650 GTGATTTAGAAATGAGTGAAGGG + Intronic
1184895222 22:47402783-47402805 GTGACTGTGGAGAGAGAGGAAGG + Intergenic
949512664 3:4780492-4780514 GAGACGGTGACATGAGTTGAGGG + Intronic
949848992 3:8402705-8402727 GTGACAGTGAAGTGAGCAGAAGG - Intergenic
952266266 3:31789547-31789569 GTGCCTGTGAAAGAAGTGGTGGG + Intronic
952570362 3:34708702-34708724 GTGAATGAGAAATAAATGGAGGG + Intergenic
953223010 3:40990477-40990499 GTTTCTGCGAAATGAGTGCAAGG - Intergenic
957487882 3:80886537-80886559 GTGATTTGGAAATAAGTGGATGG - Intergenic
957697395 3:83657990-83658012 ATGACAGTGAAATGACTGAAAGG + Intergenic
959410611 3:106016548-106016570 GTGGCTGTGAAATGTGGAGATGG + Intergenic
959740196 3:109710035-109710057 GTGACTGTGTACTGCGTAGAAGG + Intergenic
959773288 3:110125619-110125641 GTGACTTTGAATTGAATGGGAGG - Intergenic
961910117 3:130305864-130305886 CTGACTGTGAAAACAGAGGAGGG - Intergenic
962858231 3:139370041-139370063 GGGACTGGGGAATGGGTGGATGG + Intronic
963068501 3:141282626-141282648 GTGACTGACATATGAGTGGTGGG + Intronic
963361867 3:144284027-144284049 TTGACTATGAAATGACAGGAGGG + Intergenic
963741853 3:149088658-149088680 GTGACTGGGAAGTGGCTGGATGG - Intergenic
964085068 3:152807172-152807194 TTGACTGTGAAATGTGTGAAAGG + Intergenic
966443369 3:179973225-179973247 CTGACAGTGAAATGGATGGAAGG - Intronic
968029824 3:195474195-195474217 GGGGCTGAGGAATGAGTGGAAGG - Intergenic
968383011 4:111098-111120 ATGACTTTGAATTGAATGGAAGG - Intergenic
969006995 4:4028326-4028348 GTGACTTTGAATAGAATGGAAGG - Intergenic
969612380 4:8234639-8234661 GTGGCTTAGGAATGAGTGGATGG - Intronic
969827341 4:9767933-9767955 GTGACAGAGAATTGAGTGGTAGG - Intergenic
969902770 4:10364913-10364935 GTGACTGTGACAGGTGTGGCAGG + Intergenic
970331706 4:14993091-14993113 GAGACTGAGAAATGAGGAGATGG + Intergenic
970602297 4:17650112-17650134 GGGACAGAAAAATGAGTGGATGG - Intronic
971385140 4:26135305-26135327 GTGAGGGTGAAATGAGGGGACGG - Intergenic
971730128 4:30368520-30368542 GTGAGTGTGCCATTAGTGGATGG + Intergenic
974393769 4:61308356-61308378 GTGACAGTGAGAAGAGAGGAAGG + Intronic
975486328 4:74936952-74936974 GTGCCTGGGTAATGGGTGGAAGG - Intronic
975847064 4:78535897-78535919 GTCAGTGTGACAAGAGTGGAGGG - Intronic
977587704 4:98792546-98792568 GTGGCTCTGATCTGAGTGGATGG + Intergenic
978592257 4:110337280-110337302 GTGACTGTTAAATGGGTGTGGGG - Intergenic
979500637 4:121435843-121435865 GAGACTGGGAAACGAGTGGCAGG - Intergenic
979798350 4:124875826-124875848 TTGACTGTGAGAAGACTGGAGGG - Intergenic
981844855 4:149155613-149155635 GTGACTGTGCCATGATGGGAGGG + Intergenic
982803628 4:159735522-159735544 GTGACTTTGAATAGAATGGAAGG + Intergenic
983273289 4:165588507-165588529 GTGACTCTGCAATGAATGGAGGG - Intergenic
984601503 4:181732174-181732196 TTGGCTGAGAAATGACTGGATGG + Intergenic
985372997 4:189307181-189307203 ATGTTTGTTAAATGAGTGGATGG - Intergenic
985903781 5:2817345-2817367 GTGACTGTAAGATGACTGGATGG + Intergenic
986681838 5:10240591-10240613 GTGAGGATGAAATGAGTGTATGG + Intronic
986802081 5:11271768-11271790 CTGAATGAGAAATGAGTGGGAGG + Intronic
986856856 5:11879157-11879179 GTGTCTATGAAAGGAGAGGAAGG + Intronic
987051356 5:14149078-14149100 GTGCCTCTGAACTGAGGGGAAGG + Intronic
987173498 5:15283767-15283789 GGTAGTGTGGAATGAGTGGATGG - Intergenic
987266354 5:16259494-16259516 GGGACAGAGAAATGAGTGAAAGG + Intergenic
988207272 5:28155768-28155790 GTGCCTGAGAAATAAGTTGAGGG + Intergenic
988791707 5:34614418-34614440 GTGAATGAGAAGTGAGTGAATGG - Intergenic
990450727 5:55929680-55929702 GTGTCTATGAAATGTGGGGAGGG - Intergenic
990502765 5:56413094-56413116 GTGGTGGGGAAATGAGTGGATGG + Intergenic
992103106 5:73426363-73426385 CAGTCTGTGAACTGAGTGGAGGG + Intergenic
993156030 5:84224210-84224232 GGGAATCTGAAATTAGTGGATGG - Intronic
993464902 5:88233075-88233097 GTGACTGATAAATGAATGAATGG - Intronic
993570710 5:89535476-89535498 GAGATTGTGAAAAGAGAGGAAGG + Intergenic
994806615 5:104456351-104456373 GTGTGTGGGAAATGAGTTGATGG - Intergenic
995871152 5:116744688-116744710 TTGACTGTGGAATGAGTAAAAGG - Intergenic
996089158 5:119333931-119333953 GGGACTCTGAAAAGATTGGATGG + Intronic
998738070 5:145165916-145165938 TTGTCTGTGAAATGAAAGGATGG - Intergenic
999201777 5:149821816-149821838 GGGACTGTGGACTGAGTGGTCGG + Intronic
1001042677 5:168348241-168348263 GTGACTGTGATGTGTGTGCACGG + Intronic
1002261448 5:177996323-177996345 GTGACCGTGTAGTGATTGGATGG - Intergenic
1004646030 6:17561473-17561495 GTGACTTTGAATAGAGTGGGAGG + Intergenic
1005925346 6:30440141-30440163 GGGAGTGTGGAAGGAGTGGAGGG - Intergenic
1007402397 6:41610843-41610865 GTGGCTGTGAACAGAGAGGAAGG + Intergenic
1008039195 6:46777751-46777773 GTGTCTGTGAAACGGGTTGATGG - Intergenic
1008364864 6:50665878-50665900 GTGACTGTGAAAGGTTTGGAAGG + Intergenic
1008595755 6:53040089-53040111 GTGAGTGTGAAATGTCTGCAGGG + Intronic
1008653199 6:53584705-53584727 GTGACTGAGAGATGAGTGGATGG - Intronic
1009664850 6:66662866-66662888 ATGGCTGTGAAATAAGTGCATGG + Intergenic
1009862506 6:69352710-69352732 ATGACTATGAAATGAGTGAGAGG + Intronic
1010714493 6:79212556-79212578 GTAACTCTAAAATGAGAGGAAGG - Intronic
1010966138 6:82211534-82211556 GTGACCATGAAATCAGTGGATGG - Exonic
1013410176 6:109876846-109876868 GTGACTCTGAATAGAATGGAAGG + Intergenic
1013508924 6:110826999-110827021 GTGTCTGTGGAATGAGAAGAGGG - Intronic
1014010033 6:116464925-116464947 GTGAACTTGAACTGAGTGGATGG + Intergenic
1014321138 6:119929313-119929335 GTGAGTGAGTAATGAGTGGATGG + Intergenic
1016191214 6:141267482-141267504 GTGAATGTGATATGAGAGGGGGG + Intergenic
1017015368 6:150095541-150095563 ATGGCTATGGAATGAGTGGAAGG - Intergenic
1017248171 6:152250417-152250439 CTGACTGTCTAATGAGTGGAAGG + Intronic
1018561046 6:165101160-165101182 GTGCCTTTGAAATGTATGGACGG + Intergenic
1018597921 6:165503215-165503237 GTGGCTGTGAAAAGAATGGAGGG - Intronic
1018833223 6:167462318-167462340 GTGTTTGTGAAATGAGGGAATGG + Intergenic
1018858163 6:167690280-167690302 GTGACTTTGAATAGAGTGGGAGG - Intergenic
1020340546 7:7104989-7105011 GTGACTTTGAACAGAATGGAAGG - Intergenic
1021546660 7:21821012-21821034 GTGACAGTGGAAAGAGTGGAGGG + Intronic
1021777456 7:24067622-24067644 GTGACGGCCAAATAAGTGGAGGG + Intergenic
1022282304 7:28923624-28923646 ATGAATAAGAAATGAGTGGAGGG - Intergenic
1022701174 7:32761916-32761938 GCGACTGTGAAATGTGGGGTGGG + Intergenic
1024299612 7:47877017-47877039 GTGAGGGTGAAATGAGAGGATGG - Intronic
1025814952 7:64902873-64902895 GTGACTTTGAATAGAATGGAAGG + Intronic
1026438902 7:70425526-70425548 GATAATGTGGAATGAGTGGAAGG + Intronic
1028618698 7:92800117-92800139 GTGCCCTTGAAATGAGAGGAAGG - Intronic
1031272565 7:119670959-119670981 GTGATTGAGAAATGGCTGGAGGG - Intergenic
1032492211 7:132332150-132332172 GTACCTGTGAAGGGAGTGGAAGG + Intronic
1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG + Intronic
1034704360 7:153127354-153127376 GTTACTGTGAAATGGGGTGAAGG + Intergenic
1034970321 7:155415021-155415043 GTGACTTTGAATAGAGTGGGAGG + Intergenic
1035112475 7:156494782-156494804 GAAATTGTGAAAAGAGTGGAAGG + Intergenic
1036101739 8:5794665-5794687 AGGACTGAGAAATGAGAGGAGGG + Intergenic
1036197442 8:6732200-6732222 GTGACTCTGTAATAAGTGGGTGG + Intronic
1036984409 8:13511001-13511023 ATGTTTGTGAAATGAATGGAAGG - Intronic
1037090158 8:14905070-14905092 GTGACTGGGAAGTGAGTATAGGG - Intronic
1037700273 8:21267467-21267489 GGGACAGTGAAATGGATGGAGGG - Intergenic
1039244787 8:35596829-35596851 GTGACTTTGAATTGAATGGGAGG + Intronic
1040331018 8:46385804-46385826 GTGCCTGTGACACTAGTGGAAGG + Intergenic
1041118305 8:54562037-54562059 TTGACTGTCAAATGAATGGATGG + Intergenic
1044109360 8:88252372-88252394 GTGACTGAGAAATCAGTTGGAGG - Intronic
1044813257 8:96085515-96085537 GTGTCTATCAAAGGAGTGGAAGG + Intergenic
1046923378 8:119759433-119759455 CTGACTGTGGAAGGAGAGGAAGG - Intronic
1047169557 8:122478456-122478478 GTGACTATGAAATGACTTGATGG - Intergenic
1047204880 8:122795095-122795117 ATGTCTGTGGAATGACTGGATGG + Intronic
1048455237 8:134571713-134571735 GTGACAGTTAAATGAGTTAATGG - Intronic
1048876580 8:138841187-138841209 ATGTTTGTGAAATGAATGGATGG - Intronic
1051808152 9:21020004-21020026 GTGACTGTGAAATCTTTAGAGGG + Intronic
1052402001 9:28012184-28012206 GTGGCTGGGAAAAGAGTGGAGGG + Intronic
1052658447 9:31396305-31396327 GTGACTCAGAAATGAGTACAAGG - Intergenic
1053432398 9:38051633-38051655 GTGACTGTGAAGTGACGAGATGG - Intronic
1056260005 9:84839462-84839484 GTCACAGTGAAATGGGAGGACGG - Intronic
1057821146 9:98332039-98332061 CTGACTGTCAAATGAGCTGATGG - Intronic
1057872623 9:98729707-98729729 GTGACTGTTTAATGAGTAGGGGG - Intergenic
1058609172 9:106756450-106756472 TTCATTGTGAAATTAGTGGAGGG - Intergenic
1058996861 9:110307645-110307667 GTGACTTTGAAAAGAATGGGAGG - Intronic
1060020035 9:120121388-120121410 GTGGCCATGAAATCAGTGGAGGG - Intergenic
1185702957 X:2245137-2245159 GTGACTTTGAACAGAGTGGGAGG - Intronic
1186020792 X:5252873-5252895 GTGACTTTGAATAGAGTGGGAGG - Intergenic
1186785536 X:12953427-12953449 GTGACTGTGGTGTCAGTGGATGG - Intergenic
1187052706 X:15710284-15710306 GTGACTGTGAAATGAGTGGATGG + Intronic
1187404316 X:18988852-18988874 GTGACTATGAAATTAGAGCAAGG - Intergenic
1189493400 X:41487670-41487692 GTGACTTTGAATAGAATGGAAGG - Intergenic
1189546945 X:42051205-42051227 GTGGGTGTGACATGCGTGGATGG - Intergenic
1190224249 X:48533435-48533457 GGGCCTGTGAGATGAGTGGGAGG - Intergenic
1190659920 X:52644823-52644845 GTCACTGTGGCATGAGCGGATGG - Intronic
1190778225 X:53572276-53572298 GTGAAGGTGAAATGGGTGGGAGG + Intronic
1194205409 X:91005728-91005750 GTGACTTTGAAAAGAATGGGAGG + Intergenic
1194523643 X:94948639-94948661 GGGACTGGGAGATGAGGGGAGGG + Intergenic
1194578266 X:95640240-95640262 GTAAATGTTAAATGAGTGCAAGG - Intergenic
1195503982 X:105635910-105635932 ATGATTGTGAAATGAGTGGGTGG + Intronic
1196015962 X:110940299-110940321 GTAACTTTGAAATAAGTAGAGGG - Intergenic
1196070744 X:111518790-111518812 GTGACTGTGAAATGCCTCAAGGG + Intergenic
1196627586 X:117894249-117894271 GTCTTTGTAAAATGAGTGGAAGG - Intergenic
1200551226 Y:4580871-4580893 GTGACTTTGAAAAGAATGGGAGG + Intergenic
1201319347 Y:12680948-12680970 GTGACTGTGAATAGAATGGGAGG - Intergenic