ID: 1187053328

View in Genome Browser
Species Human (GRCh38)
Location X:15715653-15715675
Sequence GTCTCACTTTGTACTCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1563
Summary {0: 1, 1: 0, 2: 6, 3: 120, 4: 1436}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187053322_1187053328 19 Left 1187053322 X:15715611-15715633 CCGTGCCCAATTAATTTTTTAAA 0: 2
1: 49
2: 538
3: 3218
4: 20524
Right 1187053328 X:15715653-15715675 GTCTCACTTTGTACTCAGACTGG 0: 1
1: 0
2: 6
3: 120
4: 1436
1187053321_1187053328 22 Left 1187053321 X:15715608-15715630 CCACCGTGCCCAATTAATTTTTT 0: 2
1: 62
2: 1787
3: 21636
4: 89922
Right 1187053328 X:15715653-15715675 GTCTCACTTTGTACTCAGACTGG 0: 1
1: 0
2: 6
3: 120
4: 1436
1187053323_1187053328 14 Left 1187053323 X:15715616-15715638 CCCAATTAATTTTTTAAAAATGT 0: 1
1: 3
2: 63
3: 627
4: 3820
Right 1187053328 X:15715653-15715675 GTCTCACTTTGTACTCAGACTGG 0: 1
1: 0
2: 6
3: 120
4: 1436
1187053324_1187053328 13 Left 1187053324 X:15715617-15715639 CCAATTAATTTTTTAAAAATGTT 0: 1
1: 3
2: 61
3: 548
4: 3407
Right 1187053328 X:15715653-15715675 GTCTCACTTTGTACTCAGACTGG 0: 1
1: 0
2: 6
3: 120
4: 1436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187053328 Original CRISPR GTCTCACTTTGTACTCAGAC TGG Intronic
900316365 1:2058864-2058886 GTCTCACTCTGTGCCCAGGCTGG - Intronic
900674654 1:3877356-3877378 GTCTCACTCTGTACTCAGGCTGG + Intronic
900946844 1:5835599-5835621 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
901193395 1:7425836-7425858 GTCTCACTCTGTAGCCAGAGGGG + Intronic
901280988 1:8034848-8034870 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
901371643 1:8803438-8803460 GTCTCACTCTGTCCCCAGGCTGG - Intronic
901393500 1:8963734-8963756 GTCTCACCATGTTCTCAGGCTGG + Intronic
901522900 1:9798983-9799005 GTCTCACTTTGTTGCCAGAATGG - Intronic
902164149 1:14556137-14556159 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
902255148 1:15184067-15184089 GTCTCACTTTGTCACCAGGCTGG + Intronic
902300336 1:15497611-15497633 GTCTCGCTCTGTTGTCAGACTGG - Intronic
902313121 1:15597252-15597274 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
902449724 1:16489259-16489281 GTCTCACTCTGTCACCAGACTGG - Intergenic
902912451 1:19610110-19610132 GTCTCACTCTGTCCCCAGGCTGG - Intronic
903101041 1:21029884-21029906 GTCTCACTTTGTTGCCAGGCTGG + Intronic
903196773 1:21695677-21695699 GTCTCACTCTGTCAGCAGACTGG - Intronic
903347467 1:22695988-22696010 GTCTTACTCTGTACCCAGGCTGG - Intergenic
903381744 1:22901853-22901875 GTCTCACTTTGTCACCACACTGG + Intronic
903598237 1:24513297-24513319 GTCTCACTATGTTGTCAGGCTGG + Intronic
903954928 1:27018843-27018865 GTCTCACTCTGTCATCAGGCCGG + Intergenic
904025219 1:27498591-27498613 GTCTCACTCTGTCGCCAGACTGG + Intergenic
904510184 1:30998793-30998815 GTCTCACTTTGTCCCCAGACTGG - Intronic
904549955 1:31307602-31307624 GTCTCACTGTGTCATCAGGCTGG + Intronic
904634987 1:31873003-31873025 ATCTCACTTAGTCCCCAGACAGG - Intergenic
904659055 1:32071293-32071315 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
904750034 1:32736110-32736132 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
904782407 1:32960604-32960626 GTCTCACTCTGTGCCCAGGCTGG - Intronic
904887449 1:33751649-33751671 GTCTCACTTTGTTGCCAGGCTGG + Intronic
905067432 1:35195223-35195245 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
905085895 1:35376551-35376573 GTCTCACTTTGTTGCCAGGCTGG + Intronic
905120437 1:35677740-35677762 GTCTCACTATGCACACAGAACGG - Intergenic
905302899 1:36997715-36997737 GTCCCTCTTAGGACTCAGACTGG - Intronic
905640051 1:39582918-39582940 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
905697124 1:39982815-39982837 GTCTCACTCTGTTGTCAGGCTGG - Intergenic
905729753 1:40288898-40288920 ATCTCACTGTCTACTCAGCCTGG - Intronic
905818474 1:40970425-40970447 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
906023893 1:42656599-42656621 GTCTCACTTTTTGCCCAGGCTGG - Intergenic
906233025 1:44181893-44181915 GTCTCGCTTTGTGCCCAGGCTGG + Intergenic
906418877 1:45646583-45646605 GTCTCACTCTGTCCCCAGGCTGG + Intronic
906471968 1:46138627-46138649 GTCTCACTCTGTGCCCAGGCTGG - Intronic
906638957 1:47429904-47429926 GTCTCACTCTGTTGCCAGACTGG + Intergenic
906994483 1:50777062-50777084 GTCTCACTATGTGCCCAGACTGG - Intronic
907101561 1:51842141-51842163 GTCTCATTTTTCACCCAGACTGG - Intronic
907141111 1:52185888-52185910 GTCTCACTCTGTCCCCAGGCTGG - Intronic
907245678 1:53107124-53107146 GTCTCACTCTGTCCCCAGGCTGG - Intronic
907340724 1:53734186-53734208 CTTTCACTGTGTACTGAGACTGG - Exonic
907666839 1:56440768-56440790 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
907924018 1:58939190-58939212 GTCTCACTCTGTTGCCAGACTGG - Intergenic
908030331 1:59992448-59992470 GTTTCACTATGTGCCCAGACTGG + Intronic
908645418 1:66272816-66272838 GTCTCACTCTGTCATCAGGCTGG + Intronic
908709574 1:67000072-67000094 GTCTCACTCTGTTGCCAGACTGG - Exonic
908994224 1:70132492-70132514 GTCTCACTCTGTCATCAGGCTGG + Intronic
908995127 1:70142496-70142518 GTTTCTCTTTGTACTCAGTAGGG + Intronic
909013222 1:70356697-70356719 GTCTCACTCTGTCCCCAGGCTGG - Intronic
909036919 1:70603852-70603874 GTCTCACTTTGTCACCAGGCTGG - Intergenic
909232926 1:73115224-73115246 GTCTCACTCTGTCTTCAGGCTGG - Intergenic
909406835 1:75299984-75300006 GTCTCACTGTGTTCCCAGGCTGG - Intronic
909775720 1:79482154-79482176 GTCTCACTCTGTCATCAGACTGG - Intergenic
910205742 1:84747392-84747414 GTCTCACTTCTTACTTAGTCTGG - Intergenic
910299337 1:85688011-85688033 GTCTCACTTTGTCACCAGGCTGG - Intronic
910357124 1:86372157-86372179 GTCTCACTTTGTTGCCAGGCTGG - Intronic
910358458 1:86390388-86390410 GTCTCACTCTGTTGCCAGACTGG - Intronic
910485072 1:87703972-87703994 GTCTCACTCTGTCCCCAGAGTGG - Intergenic
910587614 1:88896563-88896585 GTTTCACTTTGTGCCCAGGCTGG - Intergenic
911540173 1:99147890-99147912 GTCTCATTTTGCACCCAGACAGG + Intergenic
911617018 1:100024646-100024668 GTCTCACTTTGTCGCCAGGCTGG + Exonic
911741979 1:101395982-101396004 GTCTCACTTATTGCCCAGACTGG - Intergenic
911761336 1:101620872-101620894 GTCTCATTCTGTAGCCAGACTGG + Intergenic
911818243 1:102382601-102382623 TTCTCACTTTGTGCTCATATGGG + Intergenic
912155202 1:106909930-106909952 GTCTCGCTTTGTTCCCAGGCTGG + Intergenic
912977228 1:114341726-114341748 GTCTCACTCTGTTCCCAGGCTGG - Intergenic
912977479 1:114343662-114343684 GTCTCACTCTTCACTCAGGCTGG + Intergenic
913164373 1:116171480-116171502 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
914439532 1:147691544-147691566 GTCTCTCTCTGTCATCAGACTGG - Intergenic
914522909 1:148434212-148434234 GTCTCACTGTGTCCCCAGGCTGG - Intergenic
915132276 1:153703858-153703880 GTCTCACTCTGTACTCAGGCTGG - Intergenic
915298685 1:154939790-154939812 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
915579629 1:156805686-156805708 GTCTTACTTTTGTCTCAGACTGG - Intergenic
916076853 1:161205736-161205758 GTCTCACTCTGCACCCAGGCTGG - Intronic
916234948 1:162577639-162577661 GTCTTACTTTGTCCCCAGGCTGG + Intronic
916294175 1:163198658-163198680 GTCTCACTCTGCACCCAGGCTGG + Intronic
916507750 1:165443452-165443474 CTCTCACTCTGTCATCAGACTGG + Intronic
916706705 1:167357831-167357853 GTCTCACTCTGTCTTCAGGCTGG + Intronic
916894959 1:169152476-169152498 CACTCACTTTGTGCCCAGACTGG - Intronic
917226991 1:172794798-172794820 GTCTCACTTATTGCACAGACTGG + Intergenic
917319679 1:173766610-173766632 GTCTCACTTTGCACCCAGGCTGG - Intronic
917468545 1:175306522-175306544 GTCTCACTCTGTCGTCAGGCTGG + Intergenic
917753714 1:178078401-178078423 GTCTCACTCTGTTGCCAGACTGG + Intergenic
917867347 1:179209902-179209924 GTCTCACTCTGCACCCAGACTGG + Intronic
917874058 1:179269480-179269502 GTCTCCCTATGTTCTCAGGCTGG + Intergenic
917999728 1:180480999-180481021 GTCTCACTCTGTTGTCAGGCTGG - Intronic
918078479 1:181188496-181188518 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
918082019 1:181215050-181215072 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
918349815 1:183643319-183643341 GTCTCACTCTGTTGCCAGACTGG + Intronic
918523535 1:185440869-185440891 GTCTCACTCTGCAGTCAGGCTGG - Intergenic
919017235 1:192054706-192054728 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
919323150 1:196069094-196069116 GTCTCACTCTGTGATCAGGCTGG + Intergenic
919541604 1:198853631-198853653 GTCTCACTCTATCATCAGACTGG + Intergenic
919542246 1:198863008-198863030 GTTTCGCTTTGTTCCCAGACTGG + Intergenic
919691997 1:200536087-200536109 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
919716659 1:200785416-200785438 GTCTCACTCTGTGCCCAGGCTGG + Intronic
919855186 1:201700979-201701001 GTCTCACTCTGTCCCCAGGCTGG - Intronic
920070900 1:203302477-203302499 GTCTCACTCTGTCATCAGGCTGG - Intergenic
920559061 1:206925943-206925965 GTCTCACTTTGTCCCCAAGCTGG + Intergenic
920698447 1:208199659-208199681 GTCTCACTTTGTCACCAGGCTGG - Intronic
920768187 1:208853634-208853656 GTCTCACTCTGTGTTCAGGCTGG + Intergenic
920955793 1:210619239-210619261 GAATCACTTTGTTCTCAGGCAGG - Intronic
920958097 1:210637828-210637850 GTCTCACTCTGTTGCCAGACTGG - Intronic
921068666 1:211641086-211641108 GTCTCACTCTGTCATCAGGCTGG - Intergenic
921088335 1:211817858-211817880 GTCTCACTCTGTCCAGAGACAGG + Intronic
921269844 1:213457645-213457667 GGATCACTTTGTACTCAAAAAGG - Intergenic
921374289 1:214458242-214458264 ATCTCACTATGTTCTCAGGCTGG + Intronic
921547764 1:216492708-216492730 GTCTCACTCTGTCATCAGGCTGG + Intergenic
921634981 1:217481660-217481682 GTCTCACTATGTGCTCAGGCTGG - Intronic
922302637 1:224315997-224316019 GTCTCACTATGTTGTCAGGCTGG - Intronic
922335369 1:224614908-224614930 GTCTCACTTTGTCGCCAGGCTGG - Intronic
922700332 1:227755713-227755735 GTCTCACTTTGTGCCCATGCTGG + Intronic
922847259 1:228696740-228696762 GTTTCACTGTGTGCTCAGGCTGG + Intergenic
923594139 1:235347111-235347133 GTCTCACTGTGTTCCCAGGCTGG - Intergenic
923645477 1:235816098-235816120 GTCTCACTTTGTTGCCAGGCTGG - Intronic
923712816 1:236400582-236400604 GTCTCGCTCTGCACTCAGGCTGG + Intronic
924122808 1:240819706-240819728 GTCTCACTCTGTTGCCAGACTGG - Intronic
924134049 1:240944741-240944763 GTCTCACTTTGTCACCAGTCTGG + Intronic
924225433 1:241917972-241917994 GTCTCACTCTGTCATCAGGCTGG + Intergenic
924351213 1:243116177-243116199 GTCTCACTCTGTCGCCAGACTGG - Intergenic
924471384 1:244345690-244345712 GTCTCACTTGTCACTCAGGCTGG - Intergenic
924688133 1:246316963-246316985 GTCTCACTTTGTCACCAGGCTGG - Intronic
924714368 1:246559142-246559164 GTCTCACTATGTCCCCAGGCTGG + Intronic
924751302 1:246894172-246894194 GTCTCACTTTTTGCCCAGGCAGG - Intronic
924753508 1:246920108-246920130 GTCTCACTGTGTCGTCAGGCTGG - Intronic
1063123105 10:3118436-3118458 GTCTCACTTTGTTACCAGGCTGG - Intronic
1063396290 10:5691159-5691181 GTCTCACTCTGTCGTCAGGCTGG - Intronic
1063412411 10:5846809-5846831 GTCTCACTTTGTCATCAAGCTGG + Intergenic
1063413258 10:5852981-5853003 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1063606873 10:7530135-7530157 GTCTCACTGTGTTCCCAGGCTGG + Intergenic
1063863108 10:10334029-10334051 GTCTCACTCTGTTGCCAGACTGG + Intergenic
1063908593 10:10806232-10806254 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
1064051078 10:12060111-12060133 GTCTCACTCTGTCACCAGACTGG + Intergenic
1064067488 10:12195128-12195150 GTCTCACTCTGTGCCCAGATTGG - Intronic
1064073389 10:12249097-12249119 GTCTCGCTCTGTTCTCAGACTGG - Intronic
1064174201 10:13060052-13060074 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1064202120 10:13293659-13293681 GTCTCACTATGTTGCCAGACTGG + Intronic
1064250645 10:13703973-13703995 GTCTCACTTTGTCCCCAGGCTGG - Intronic
1064787279 10:18911894-18911916 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1064791047 10:18958357-18958379 GTCTCACTGTGTCGTCAGGCTGG - Intergenic
1064987776 10:21228347-21228369 GTCTCACTTTTTGCCCAGGCTGG + Intergenic
1065318752 10:24489210-24489232 GTCTCACTCTGTTCCCAGGCTGG - Intronic
1065337928 10:24673830-24673852 GTCTCACTCTGCACCCAGGCTGG - Intronic
1065451934 10:25868326-25868348 GTCTCACTTGTCACCCAGACTGG - Intergenic
1065713536 10:28541453-28541475 GTCTCACTCTGTACCTAGGCTGG + Intronic
1065848271 10:29764489-29764511 GTCTCACTCTGTCCCCAGACTGG + Intergenic
1065871098 10:29957022-29957044 GTCTTACTATGTACCCAGGCTGG + Intergenic
1066320365 10:34297106-34297128 GTCTCACTGTGTTGTCAGGCTGG - Intronic
1066403725 10:35099359-35099381 GTCTCACTTTGTCGCCAGGCTGG - Intergenic
1067298149 10:44987132-44987154 GTCTCACTCTGTAGCCAGGCTGG + Intronic
1067397286 10:45933759-45933781 GTCTCACTCTGTCGCCAGACTGG + Intergenic
1067729508 10:48799913-48799935 GTCTCACTCTGTTGCCAGACCGG + Intronic
1067865611 10:49902860-49902882 GTCTCACTCTGTCACCAGACTGG + Intronic
1068124095 10:52816401-52816423 GTCTCACTCTGTCACCAGACTGG - Intergenic
1068260661 10:54577110-54577132 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1068660857 10:59622123-59622145 GTCTCACTCTGTTGCCAGACTGG + Intergenic
1068723985 10:60280252-60280274 GTCTCACTATGTTCCCAGGCTGG + Intronic
1068842383 10:61630006-61630028 GTCTCACTATGTTGTCCGACTGG - Intergenic
1068896260 10:62205955-62205977 GGCTCACATTGTACTTATACTGG - Intronic
1069005753 10:63315808-63315830 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1069176024 10:65289256-65289278 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1069240984 10:66138827-66138849 GTCTCCCTTTGTTCCCAGGCTGG - Intronic
1069308351 10:67001269-67001291 GTCTCACTCTGTCGTCAGGCTGG - Intronic
1069442695 10:68443155-68443177 ATCTCACTTCGTACCCAGCCAGG - Intronic
1069451440 10:68521102-68521124 GTCTCACTTTGTCACCAGGCTGG - Intronic
1069485783 10:68822212-68822234 GTCTCACTCTGTCGTCAGGCTGG + Intergenic
1069497163 10:68915684-68915706 GTCTCACTCTGTCTCCAGACTGG - Intronic
1069518198 10:69096778-69096800 GTCTCACTATGTGCCCAGGCTGG - Intronic
1069742135 10:70691459-70691481 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1070037420 10:72740347-72740369 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1070044628 10:72820538-72820560 GTCTCACTTGTTGCTCAGGCTGG + Intronic
1070095667 10:73335943-73335965 GTCTCACTTTGTTGCCAGCCTGG - Intronic
1070115386 10:73523935-73523957 GTCTCACTGTGTTCCCAGGCTGG + Intronic
1070236953 10:74638464-74638486 GTCTCACTATGTTCCCAGGCTGG - Intronic
1070245111 10:74723429-74723451 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
1070379405 10:75867190-75867212 GTCTCACTCTGTTGCCAGACTGG + Intronic
1070398121 10:76030757-76030779 GTCTCACTCTGTCATCAGGCTGG - Intronic
1070440934 10:76442493-76442515 GTCTCACTATGTGCCCAGGCTGG - Intronic
1070531919 10:77344261-77344283 GGCTTACTTTCTACTCAGCCTGG - Intronic
1071147797 10:82595753-82595775 GTCTCACTCTGTCACCAGACTGG - Intronic
1071901146 10:90121177-90121199 CTCAGACTTTGGACTCAGACTGG - Intergenic
1072021067 10:91402178-91402200 GTCTCACTTTGTCTCCAGGCTGG - Intergenic
1072104541 10:92261475-92261497 GTCTCACTTTGTGCCCAGGCTGG + Intronic
1072250106 10:93574867-93574889 GTCTCACTTTGTTGCCAGTCTGG - Intronic
1072343477 10:94478924-94478946 GTCTCGCTTTGTCACCAGACTGG - Intronic
1072412609 10:95217316-95217338 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1072516290 10:96186425-96186447 GTCTCTCTCTGTCATCAGACTGG + Intronic
1072626339 10:97114627-97114649 GTCTCACTTTGTCACCAGGCTGG - Intronic
1072657543 10:97340649-97340671 GTCTCTCTTTGTGCTCAAGCTGG - Intergenic
1072713467 10:97733796-97733818 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1072919050 10:99560100-99560122 GTCTCACTGTGTCCCCAGGCTGG + Intergenic
1072929384 10:99648026-99648048 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1073155170 10:101340686-101340708 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1073157823 10:101361988-101362010 GTCTCACTCTGTCGCCAGACTGG + Intronic
1073272732 10:102279921-102279943 GTCTCACTAGTTACTCAGGCTGG - Intronic
1073466133 10:103695477-103695499 GTCTCACTTGTCACTCAGGCTGG - Intronic
1073782969 10:106859421-106859443 GTCTCACTTTGTCACCAGGCTGG + Intronic
1074072481 10:110086378-110086400 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1074105399 10:110385800-110385822 GTCTCACTCTGTCACCAGACTGG + Intergenic
1074347154 10:112698318-112698340 GTCTCACTGTGTATTCAGTGTGG + Intronic
1074803083 10:117021373-117021395 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1074816657 10:117147006-117147028 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1074820211 10:117172941-117172963 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1074845837 10:117397017-117397039 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
1074990104 10:118698173-118698195 GTCTCACTCTGTAGCCAGGCTGG + Intronic
1075033842 10:119045756-119045778 GTCTCACTATGTTGCCAGACTGG + Intronic
1075386392 10:122058436-122058458 GTCTCACTCTGTCGCCAGACAGG + Intronic
1075930782 10:126293546-126293568 GTCTCACTCTTCACCCAGACTGG + Intronic
1076134285 10:128034644-128034666 GTCTCACTCTGTTGCCAGACTGG - Intronic
1076376006 10:129985349-129985371 GTCTTGCTTTGTCATCAGACTGG - Intergenic
1076399436 10:130171088-130171110 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1077525144 11:3059704-3059726 GTCTCACTCTGCACCCAGGCTGG - Intergenic
1077775899 11:5271260-5271282 GTCTCACTCTGTTGCCAGACTGG + Intronic
1077942874 11:6862164-6862186 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1078100092 11:8325323-8325345 GTCTCACTTTGTGCTTAAGCTGG + Intergenic
1079084866 11:17438070-17438092 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1079192395 11:18290890-18290912 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1079805936 11:24931179-24931201 GTCTCACTCTGTCATCAGACTGG - Intronic
1079914962 11:26358199-26358221 GTCTCACTCTGTCGTCAGGCTGG + Intronic
1080044969 11:27799026-27799048 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1080182301 11:29439997-29440019 GTCTCACTATATGCTCAGGCTGG - Intergenic
1080363178 11:31540513-31540535 GTCTCACTATGTTGCCAGACTGG + Intronic
1080469793 11:32534164-32534186 GTCTCACTCTGTTGCCAGACTGG - Intergenic
1080536535 11:33227190-33227212 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1080541352 11:33268397-33268419 GTCTCACTATATACCCAGGCTGG - Intronic
1080599212 11:33806321-33806343 GTCTCACTTTGTGCCCAGGCTGG + Intergenic
1081170992 11:39870121-39870143 GTCTCACTCTGTCATCAGGCTGG + Intergenic
1081409942 11:42745884-42745906 GTCTCACTCTGTAGCCAGACTGG - Intergenic
1081457038 11:43233771-43233793 GTCTCACTTTGTTGTGAGGCTGG - Intergenic
1082686604 11:56245830-56245852 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
1082757921 11:57096502-57096524 GTCTCACTCTGTTGCCAGACTGG + Intergenic
1082815602 11:57506504-57506526 GTCTCACTCTGTCACCAGACTGG - Intronic
1082842054 11:57697798-57697820 GTCTCACTCTGTCACCAGACTGG - Intronic
1083172817 11:60933211-60933233 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1083241833 11:61394396-61394418 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1083387642 11:62323621-62323643 GTCTCGCTTTGTCCTCAGGCTGG - Intergenic
1083420461 11:62549625-62549647 GTCTCGCTCTGTTGTCAGACTGG - Intronic
1083469072 11:62870209-62870231 GTCTCACTTTGTTGCCAGCCTGG + Intronic
1083881232 11:65549439-65549461 GTCTCACTCTGTCCCCAGGCCGG + Intronic
1083908574 11:65691098-65691120 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
1084202173 11:67567337-67567359 GTCTCGCTTTGTCACCAGACTGG - Intergenic
1084335309 11:68454228-68454250 GTTTCACTCTGTCCTCAGGCTGG - Intergenic
1084604731 11:70165823-70165845 GTCTCGCTTTGTGCTTAGGCTGG - Intronic
1084722312 11:70914867-70914889 GTCTCGCTTTGTCAACAGACTGG - Intronic
1084829605 11:71758943-71758965 GTCTCACTCTGTCACCAGACTGG + Intergenic
1085226279 11:74924035-74924057 GTCTCATTTTGTTCCCAGGCTGG + Intronic
1085364964 11:75932312-75932334 GTCTCACTCTGTCATCAGGCTGG + Intronic
1085950231 11:81321742-81321764 GTCTCACTCTGTTCCCAGGCTGG + Intergenic
1087695782 11:101374354-101374376 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
1088368616 11:109064830-109064852 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1088478230 11:110266594-110266616 GTCTCACTCTGTACCCACAATGG + Intronic
1088497661 11:110447422-110447444 GTCTCACTTTGCTGCCAGACTGG - Intronic
1088635963 11:111820878-111820900 GTCTCACTATGTTCCCAGGCTGG - Intronic
1088647938 11:111932058-111932080 GTCTCACTCTGTTCCCAGGCTGG + Intronic
1088715644 11:112546968-112546990 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1089518850 11:119050519-119050541 GTCTCACTATGTTGCCAGACTGG - Intronic
1089545242 11:119219346-119219368 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1089607398 11:119649349-119649371 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1089948994 11:122508097-122508119 GTCTCACTCTATACCCAGGCTGG - Intergenic
1090008331 11:123022532-123022554 GTCTCACTCTGCACCCAGGCTGG - Intergenic
1090351143 11:126109268-126109290 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1090806403 11:130205154-130205176 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1090814104 11:130275655-130275677 GTCTCACTCTGTTGCCAGACTGG + Intronic
1091155371 11:133367004-133367026 GTCTCACTTTGTCACCAGGCTGG + Intronic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1091515846 12:1180841-1180863 GTCTCACTCTGTGCCCAGGCTGG + Intronic
1092026112 12:5241952-5241974 GTCTCACTCTGTCGCCAGACTGG - Intergenic
1092028564 12:5263880-5263902 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1092131837 12:6118415-6118437 GTCTCACTCTGTGCCCAGGCTGG + Intronic
1092202885 12:6597734-6597756 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1092656929 12:10695598-10695620 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1093028868 12:14269873-14269895 GTCTCACTCTGTCCTCAGGCTGG + Intergenic
1093340792 12:17971332-17971354 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1093375737 12:18425419-18425441 GTCTCACTTTGTCACCAGGCTGG + Intronic
1093690940 12:22107871-22107893 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1094091311 12:26653272-26653294 GTCTCACTCTGTCGTCAGGCTGG + Intronic
1094274359 12:28654404-28654426 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1094367093 12:29695334-29695356 GTCTCACTTTGTTGACAGGCTGG + Intronic
1094368600 12:29711172-29711194 GTCTCACTGTGTGCCCAGGCTGG + Intronic
1094574126 12:31668415-31668437 GTCTCACTTTGCTCCCAGGCTGG + Exonic
1094603119 12:31927559-31927581 GTCTCCCCATGTACTCAGGCTGG + Intergenic
1094666885 12:32529142-32529164 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1095181295 12:39149583-39149605 GTCTCACTCTGTCACCAGACTGG + Intergenic
1095300008 12:40573336-40573358 GTCTCACTTTTCACTGACACTGG + Intergenic
1095890357 12:47230112-47230134 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1096019691 12:48313628-48313650 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1096037928 12:48489453-48489475 GTCTCACTCTGTGCCCAGGCTGG + Intronic
1096216795 12:49802276-49802298 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1096625057 12:52889795-52889817 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1097358386 12:58628619-58628641 GTCTCACTCTGTAGCCAGGCTGG - Intronic
1097803924 12:63944805-63944827 GGTTCACTTTGTAGCCAGACAGG + Intronic
1097845416 12:64361187-64361209 GTCTCACTTTGTCTCCAGGCTGG - Intronic
1097982840 12:65751982-65752004 GTCTCACTTTGTCCCCCGGCTGG + Intergenic
1098345311 12:69496406-69496428 GTCTCACTCTGTCACCAGACTGG - Intronic
1098717823 12:73854491-73854513 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1098769040 12:74529543-74529565 GTCTCACTTTGTCAGCAGGCTGG + Intergenic
1098947331 12:76602935-76602957 GTCTCACTTTTCACCCACACTGG - Intergenic
1099142316 12:78994563-78994585 GTCTCACTCTGTCGTCAGGCTGG + Intronic
1099219717 12:79898424-79898446 GTCTCACTCTGTCATCAGGCTGG - Intronic
1099224078 12:79948458-79948480 GTCACACTCTGTACCCAGGCGGG + Intergenic
1099238352 12:80110095-80110117 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
1099409045 12:82301911-82301933 GTCTCACTCTGTAGCCAGGCTGG + Intronic
1099710561 12:86219148-86219170 GTCTCACTCTGTCATCAGGCTGG - Intronic
1099917727 12:88915805-88915827 GTCTCACTTGCTCCTCAGCCTGG + Intergenic
1100059843 12:90561031-90561053 GTCTCACTCTGTCCCCAGGCGGG - Intergenic
1100262853 12:92949347-92949369 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1100414178 12:94354970-94354992 GTCTCACTCTGTAGCCAGGCTGG - Intronic
1100516023 12:95328460-95328482 GTCTCACTCTGTCACCAGACTGG - Intergenic
1100727805 12:97427508-97427530 GGCTCACTTTGTGCCCAGGCTGG + Intergenic
1100842005 12:98622044-98622066 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1101112097 12:101496296-101496318 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1101135131 12:101735629-101735651 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1101457305 12:104847573-104847595 GTCTCACTCTGTCGTCAGGCTGG - Intronic
1101691779 12:107089362-107089384 GTCTCTCTGTGTACCCAGGCTGG + Intronic
1101871438 12:108568859-108568881 GTTTCAATTTGTAATCAGCCAGG - Exonic
1102156959 12:110737887-110737909 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1102165940 12:110806821-110806843 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1102205433 12:111087336-111087358 GTCCCACTCTGTGCCCAGACTGG - Intronic
1102244301 12:111345414-111345436 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1102244400 12:111346076-111346098 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1102288837 12:111682469-111682491 GTCTCACTTTGTCCCCAGGTGGG - Intronic
1102312330 12:111855795-111855817 GTCTCACTTTGTCACCAGGCTGG - Intronic
1102497796 12:113331356-113331378 GTCTCACTCTATACCCAGGCTGG - Intronic
1102507281 12:113391685-113391707 GTCTCACTCTGTCGCCAGACTGG + Intergenic
1102872162 12:116422560-116422582 GTCTCACTTTGTCCCCAGGCTGG + Intergenic
1102906669 12:116681718-116681740 GTCTCACTCTGCACCCAGGCTGG + Intergenic
1102921365 12:116794068-116794090 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1103151668 12:118645437-118645459 GTCTCATTTTGTAACCAGAAGGG + Intergenic
1103273749 12:119694775-119694797 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1103273977 12:119696553-119696575 GTCTCACTCTGTGCCCAGGCTGG + Intronic
1103597601 12:122033341-122033363 GTCTCACTCTGTTGCCAGACTGG + Intronic
1103666199 12:122567929-122567951 ATCTCACTATGTGCTCAGGCTGG - Intronic
1103696956 12:122823671-122823693 GTCTCACTGTGTTCCCAGGCTGG - Intronic
1103801351 12:123539834-123539856 GTCTCGCTTTGTCACCAGACTGG + Intergenic
1104163212 12:126200904-126200926 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
1104314074 12:127680869-127680891 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
1104385084 12:128343392-128343414 GTCTCACTTTGTCACCAGGCTGG - Intronic
1104413164 12:128576222-128576244 GTCTCGCTCTGTACCCAGGCTGG - Intronic
1104538851 12:129643872-129643894 GTCTCACTCTGTCACCAGACTGG + Intronic
1104565591 12:129878604-129878626 GTCTCGCTTTGTGCCCAGGCTGG + Intronic
1104699158 12:130888479-130888501 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1105014650 12:132778863-132778885 GTCTCACTTTGTCACCAGGCTGG - Intronic
1105039756 12:132953454-132953476 GTCTCACTCTGTCATCAGGCTGG + Intronic
1105703312 13:22950043-22950065 GTCTCACTCTGTCGCCAGACTGG + Intergenic
1105738710 13:23299480-23299502 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1105824938 13:24113838-24113860 GTCTCACTCTGTCGCCAGACTGG - Intronic
1105967197 13:25395871-25395893 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1106518794 13:30478313-30478335 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1106590633 13:31095668-31095690 GTCTCGCTTTGTGCCCAGGCTGG + Intergenic
1107197935 13:37676400-37676422 GTCTCACTTTGTTGCCAGGCTGG + Intronic
1107582574 13:41806846-41806868 GTCTCACTCTGTTGCCAGACTGG - Intronic
1107601426 13:42016872-42016894 GTCTCACTCTGTCACCAGACTGG - Intergenic
1107698180 13:43021353-43021375 GTCTCACTCTGTCCTCAGGCTGG + Intergenic
1107899678 13:44999607-44999629 GTCTCACTCTGTCACCAGACTGG + Intronic
1108028682 13:46205715-46205737 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1108040701 13:46337170-46337192 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
1108153598 13:47562422-47562444 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1108344268 13:49529642-49529664 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
1108377476 13:49827099-49827121 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1108593273 13:51929165-51929187 GTCTCACTCTGTCCTCAAACAGG - Intergenic
1108817399 13:54308289-54308311 GTCTCGCTCTGTCCTCAGGCTGG - Intergenic
1108930819 13:55815945-55815967 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1109063996 13:57660214-57660236 GTCTCATTTTGTCATCAGGCTGG - Intronic
1109078532 13:57867954-57867976 GTCTCCCATTGTCCCCAGACGGG - Intergenic
1109610732 13:64761965-64761987 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
1109913993 13:68955840-68955862 GTCTCACTCTGTCACCAGACTGG + Intergenic
1110025194 13:70528730-70528752 GTCTCACTTTGTGCCCAGGCGGG - Intergenic
1110030821 13:70610639-70610661 GTCTCACTCTGTTGTCAGGCTGG - Intergenic
1110106048 13:71677747-71677769 GTCTCACTCTGTTGTCAGGCTGG + Intronic
1110374461 13:74776649-74776671 GTCTCACTGTGTTGTCAGGCTGG - Intergenic
1110765024 13:79273528-79273550 GTCTCACTCTGTCACCAGACTGG + Intergenic
1110858864 13:80326010-80326032 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1110943994 13:81390001-81390023 GTCTCACTCTGTTCCCAGGCTGG - Intergenic
1111434375 13:88187354-88187376 GTCTCACTCTGTCGTCAGGCTGG - Intergenic
1111537388 13:89620626-89620648 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1111555333 13:89874000-89874022 GTCTCACTTTGTTGTCAGGCTGG + Intergenic
1111686214 13:91503748-91503770 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1111831097 13:93330495-93330517 GTCTCACTCTGCACCCAGGCTGG - Intronic
1112368978 13:98778294-98778316 GTCTCACTCTGTACTCACCCAGG + Intergenic
1112550392 13:100415206-100415228 GTCTCACTATGTGCCCAGGCTGG - Intronic
1112804756 13:103151788-103151810 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1113275664 13:108726527-108726549 GTCTCACTTTGTCACCAGAATGG - Intronic
1113387417 13:109861663-109861685 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1113700449 13:112382279-112382301 GTCTCACTCTGTTGCCAGACTGG + Intronic
1113727334 13:112614989-112615011 GTCTCACTTTGTTGTCACCCAGG + Intergenic
1114037990 14:18647383-18647405 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1114264659 14:21066347-21066369 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1114268332 14:21086180-21086202 GTCTCACTATGTGCCCAGGCTGG - Intronic
1114469633 14:22951028-22951050 GTCTCACTCTGTGCCCAGGCTGG + Intronic
1114510104 14:23251784-23251806 GTCTCACTCTGTTGCCAGACTGG - Intronic
1114590089 14:23855915-23855937 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1114952058 14:27767326-27767348 GTCTCACTCTGTATCCAGGCTGG + Intergenic
1115033210 14:28824435-28824457 GTCTCACTTTGTCATCAGGCTGG + Intergenic
1115092749 14:29598078-29598100 GTCTCACTATGTGCCTAGACTGG - Intronic
1115246714 14:31303080-31303102 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1115267006 14:31510852-31510874 GTCTCACTATGTGCCCAGGCTGG - Intronic
1115567400 14:34636587-34636609 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1115592799 14:34880276-34880298 GTCTCACTGTGTCCCCAGGCTGG - Intergenic
1115693659 14:35873754-35873776 GTCTCACTCTGTCACCAGACTGG - Intronic
1116562122 14:46393429-46393451 GTCTCTCTCTGTACACAAACAGG + Intergenic
1116659066 14:47684432-47684454 GTCTCACTATGTTCCCAGGCTGG + Intergenic
1117165410 14:53028099-53028121 GTCTCACTTGCTGCTCAGGCTGG + Intergenic
1117212104 14:53511352-53511374 GTCTCACTCTGTCTCCAGACTGG - Intergenic
1117224458 14:53640366-53640388 GTCTCGCTCTGTAGTCAGGCTGG + Intergenic
1117280264 14:54233829-54233851 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1117356105 14:54925178-54925200 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
1117660614 14:58000623-58000645 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1117666875 14:58065210-58065232 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1117693096 14:58328961-58328983 GTCTCACTCTGTCGTCAGGCTGG - Intronic
1117749163 14:58902613-58902635 GTCTCACTCTGTATCCAGGCTGG - Intergenic
1117926022 14:60779754-60779776 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1117993787 14:61459873-61459895 GTCTCACTTTGTCACCAGGCTGG + Intronic
1118618657 14:67594621-67594643 GTCTCACTCTGTCATCAGGCTGG - Intronic
1118746499 14:68777225-68777247 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1118825777 14:69379635-69379657 GTCTCACTCTGTACCCAAGCTGG - Intergenic
1118831785 14:69440255-69440277 GTCTCACTCTGTACCCAGGTTGG - Intronic
1119020027 14:71102301-71102323 GTCTCACTTTGGGCCCAGGCTGG + Intronic
1119332590 14:73806059-73806081 GTCTCACTCTGTTGCCAGACTGG - Intergenic
1119402525 14:74373309-74373331 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
1119414727 14:74462054-74462076 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1119503729 14:75153797-75153819 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1119734883 14:76975501-76975523 GTCTCACTCTGTCGCCAGACTGG + Intergenic
1119789241 14:77334199-77334221 GTCTCACTTTGTCGCCAGGCTGG - Intergenic
1119845611 14:77827320-77827342 GTCTCACTCTGTAGCCAGGCTGG - Intronic
1119951749 14:78752384-78752406 ATCTCACTCTGTGCTCAGGCTGG - Intronic
1120093293 14:80358967-80358989 GTCTTACTTTGCACCCAGGCTGG - Intronic
1120099088 14:80423969-80423991 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1120235171 14:81882189-81882211 GTCTCACTCTGTCGTCAGGCTGG - Intergenic
1120679977 14:87469556-87469578 GTCTCACTCTGTACCCAGGCTGG + Intergenic
1120791246 14:88585404-88585426 GTCTCACTTTGTTGCCAGGCTGG + Intronic
1121073037 14:91042479-91042501 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1121199044 14:92102121-92102143 GTCTCACTTTGTCACCAGGCTGG - Intronic
1121559261 14:94862444-94862466 GTCTCACTCTGTTGCCAGACTGG + Intergenic
1121762771 14:96460018-96460040 GTGTCGCTTTGAACTCAAACTGG + Intronic
1121900299 14:97687666-97687688 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1121900571 14:97689999-97690021 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1122158911 14:99768745-99768767 GTCTCCCTTTGTCATCAGGCTGG + Intronic
1122471214 14:101967795-101967817 GTCTCACTCTGTACCCAGGCTGG - Intronic
1122490484 14:102112200-102112222 GTCTCACTCTGTTCCCAGACTGG + Intronic
1122553417 14:102562670-102562692 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1122701460 14:103592141-103592163 GTCTCGCTTTGTCGTCAGGCTGG - Exonic
1122966728 14:105133175-105133197 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1123009910 14:105344110-105344132 GTCTCCCTGTGTACCCAGGCTGG + Intronic
1123891980 15:24790932-24790954 GTCTCACTTTGTCGCCAGGCTGG - Intergenic
1123927110 15:25126266-25126288 GTCTCACTTTGCACCCAGGCTGG + Intergenic
1124026137 15:25967656-25967678 GTCTCACTCTGTCACCAGACTGG + Intergenic
1124183561 15:27500979-27501001 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1124803642 15:32859839-32859861 GTCTCACTGTGTTGCCAGACTGG - Intronic
1124907887 15:33888778-33888800 GTCTCACTCTGTCACCAGACTGG + Intronic
1124949866 15:34307515-34307537 GTCTCACTATGTTCTCAGGCTGG + Intronic
1124996478 15:34727831-34727853 GTCTCGCTCTGTCCTCAGGCTGG - Intergenic
1125176528 15:36829153-36829175 GTCTCACTCTGTTGCCAGACTGG + Intergenic
1125555493 15:40581284-40581306 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1125662810 15:41407639-41407661 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
1125813793 15:42566170-42566192 GTCTCACTCTGTTGCCAGACTGG - Intronic
1125898447 15:43323000-43323022 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1126174718 15:45724884-45724906 GTCTCACTCTGTCATCAGGCTGG + Intergenic
1126486374 15:49186567-49186589 GTCTCACTCTGTCGTCAGGCTGG + Intronic
1126494713 15:49277764-49277786 GTCTCACTCTGTCCGCAGGCTGG - Intronic
1126828659 15:52576865-52576887 GTCTCACTTGTTACTGAGGCTGG + Intergenic
1126903974 15:53344550-53344572 GTATCTCTTTGTTCTCAGAATGG - Intergenic
1126999335 15:54483523-54483545 GTCTCACTTTGTTACCAGGCTGG + Intronic
1127220136 15:56870966-56870988 GTCTCACTTGGTGCCCAGACTGG - Intronic
1127515811 15:59692316-59692338 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
1127934597 15:63624664-63624686 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1127956859 15:63861351-63861373 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
1128281175 15:66396034-66396056 GTCTCACTCTGTCCCCAGACTGG + Intronic
1128696270 15:69765417-69765439 GTCTCACTTTGTCTCCAGGCTGG + Intergenic
1128884306 15:71272366-71272388 GTCTCACTTTGTCCCCTGGCTGG - Intronic
1129062454 15:72871157-72871179 GTCTCGCTTTGTAGCCAGGCTGG + Intergenic
1129218465 15:74116165-74116187 GTCTCACTATGTGCCCAGGCTGG - Intronic
1129355345 15:74987152-74987174 GTCTCACTTTGTCATCAGACTGG - Intronic
1129365094 15:75049255-75049277 GTGTCCCTCTGTACTCAGAATGG + Exonic
1129405882 15:75317396-75317418 GTCTCACTATGTGCCCAGGCTGG + Intergenic
1129496660 15:75988884-75988906 GTCTCACTCTGTGCCCAGGCCGG + Intronic
1129576080 15:76747470-76747492 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1129813269 15:78528422-78528444 ATCTCCCTGTGTACACAGACAGG + Intronic
1129987114 15:79927633-79927655 GTCTCGCTCTGTACCCAGGCTGG - Intergenic
1130330241 15:82916829-82916851 GTCTCACTCTGTTGCCAGACTGG + Intronic
1130358715 15:83160214-83160236 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1131109064 15:89753008-89753030 GTCTCACTCTGTCATCAGACTGG - Intergenic
1131167575 15:90153517-90153539 GTCTCACTGTGTGCCCAGGCTGG + Intergenic
1131596642 15:93804332-93804354 GTCTCACTCTGTCCCCAGGCAGG - Intergenic
1131674880 15:94661815-94661837 GTCTCACTCTGTCGTCAGCCTGG + Intergenic
1132163090 15:99561686-99561708 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1132382336 15:101374980-101375002 GTCTCACTCTGTCCGCAGGCTGG + Intronic
1132425818 15:101716044-101716066 GTCTCACTTTGTTGCCAGGCTGG + Intronic
1132762304 16:1515590-1515612 GTCTCACTTGTTACCCAGGCTGG + Intronic
1133095905 16:3445301-3445323 GTCTCACTCTGTAGCCAGACTGG + Intronic
1133290138 16:4714960-4714982 GTCTCACTCTGTCTTCAGGCTGG - Intronic
1133354793 16:5127922-5127944 GTCTCACTCTGTCACCAGACTGG - Intergenic
1133378040 16:5305860-5305882 GTCTCACTATGTTCCCAGACTGG - Intergenic
1133579412 16:7128848-7128870 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1133684918 16:8157476-8157498 GTCTCACTCTGTCGTCAGGCTGG + Intergenic
1133757999 16:8776926-8776948 GTCTTGCTTTGTACCCAGGCTGG + Intronic
1133761194 16:8799575-8799597 GTCTCACTCTGTCACCAGACTGG + Intronic
1134140385 16:11713250-11713272 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1134306633 16:13038936-13038958 GTCTCACTCTGTTTTCAGACTGG + Intronic
1134635343 16:15787510-15787532 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1135050833 16:19191812-19191834 GTCTCACTTTGTCGCCAGACTGG + Intronic
1135427128 16:22347965-22347987 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1135580111 16:23618281-23618303 GTCTCACTCAGTACCCAGGCTGG - Intronic
1135710992 16:24716925-24716947 GTCTCACTCTGTTGTCAGGCTGG - Intergenic
1135739854 16:24965444-24965466 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1135861852 16:26063480-26063502 GTCTCACTATGTGCCCAGGCTGG - Intronic
1135928976 16:26720631-26720653 GTCTCACTCTGTCACCAGACTGG + Intergenic
1136122112 16:28144428-28144450 GTCTCACTATGTTCCCAGCCTGG + Intronic
1136162442 16:28429263-28429285 GTCTCACTTTGTCGCCAGGCTGG - Intergenic
1136162870 16:28432209-28432231 GTCTCACTCTGTTATCAGGCTGG - Intergenic
1136200095 16:28682771-28682793 GTCTCACTCTGTTATCAGGCTGG + Intergenic
1136200524 16:28685726-28685748 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1136216443 16:28796960-28796982 GTCTCACTCTGTTATCAGGCTGG + Intergenic
1136216869 16:28799919-28799941 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1136506676 16:30708846-30708868 GTCTCGCTTTGTTCCCAGGCTGG + Intronic
1136507868 16:30717640-30717662 GTCTCGCTCTGTCCTCAGGCTGG + Intronic
1136523101 16:30810292-30810314 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1136617574 16:31407999-31408021 GTCTCACTTTGTCCCCAGGCTGG + Intronic
1137255056 16:46768357-46768379 GTCTCACTCTGTTGCCAGACTGG + Intronic
1137283621 16:46998938-46998960 GTCTCACTATGTTGTCAGGCTGG - Intergenic
1137413600 16:48250450-48250472 GTCTCACTTTGTCACCAGGCTGG - Intronic
1137902295 16:52281771-52281793 TTCTCACTCTGTACTCACATGGG - Intergenic
1138654775 16:58484909-58484931 GTCTCGCTTTGTCCCCAGGCTGG + Intronic
1138850538 16:60623630-60623652 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1139501980 16:67374164-67374186 GTCTAGCTTTGTACCCAGGCTGG - Intronic
1139575744 16:67841163-67841185 GTCTCACTGTGTCGCCAGACTGG - Intronic
1139685534 16:68600383-68600405 GTCTCACTGTGTACCCAGGCTGG - Intergenic
1139757886 16:69159656-69159678 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1140087757 16:71811691-71811713 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1140171679 16:72611192-72611214 GTCTCACTTTTCACCCAGGCTGG - Intergenic
1140225456 16:73072924-73072946 GTCTCACTCTGTGCCCAGACTGG + Intergenic
1140420280 16:74813507-74813529 ACCTTACTTTGTACACAGACTGG + Intergenic
1140460781 16:75138064-75138086 GTCTCACTCTGTTTTCAGGCTGG + Intergenic
1140657276 16:77153802-77153824 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1140694493 16:77519026-77519048 GTCTCACTCTGTGGCCAGACTGG + Intergenic
1140728305 16:77833719-77833741 GTCTCACTTTGTCACCAGGCCGG - Intronic
1140807325 16:78544979-78545001 GTCTCACTATGTGCCCAGGCTGG - Intronic
1141057472 16:80832040-80832062 GTCTCACTCTGTCACCAGACTGG + Intergenic
1141418041 16:83892208-83892230 GTCTCACTTTGTTCCCAGGCTGG + Intergenic
1141456885 16:84148626-84148648 GTCTCACTTTGTTGCCAGGCTGG + Intronic
1141589000 16:85055116-85055138 GTCTCACTGTGTGCCCAGGCTGG + Intronic
1141637963 16:85325162-85325184 GTCTCACTGTGTTCCCAGGCTGG + Intergenic
1141678877 16:85532455-85532477 GTCTCCCTTTGTAGCCAGGCTGG + Intergenic
1142375604 16:89705480-89705502 GTCTCGCTCTGTGCTCAGGCTGG + Intergenic
1142568459 17:856161-856183 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1142686354 17:1579108-1579130 GTCTCACTTTGTCACCAGGCTGG - Intronic
1143026879 17:3946212-3946234 GTCTCACTCTGTTGCCAGACTGG - Intronic
1143049734 17:4115049-4115071 GTCTCACTCTGTTCCCAGGCTGG + Intronic
1143175879 17:4954865-4954887 GTCTCACTTTGTCACCAGGCTGG - Intronic
1143369861 17:6432658-6432680 GTCTCACTCTGTCGCCAGACTGG + Intronic
1143435609 17:6922305-6922327 GTCTCACTCTGTCACCAGACTGG - Intronic
1143484404 17:7245432-7245454 GTCTCACTCTGTTCCCAGGCTGG - Intronic
1143728170 17:8864565-8864587 GTCTCACTCTGTCGCCAGACTGG + Intronic
1144173004 17:12677920-12677942 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1144241246 17:13314770-13314792 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1144277329 17:13685917-13685939 GTCTCACTCTGTTATCAGGCTGG - Intergenic
1144297938 17:13897125-13897147 GTCTCACTCTGTCGCCAGACTGG + Intergenic
1144488125 17:15684463-15684485 GTCTCGCTCTGTCGTCAGACTGG + Intergenic
1144489583 17:15697078-15697100 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1144517274 17:15927451-15927473 GTCTCACTCTGTTGCCAGACTGG - Intergenic
1144568453 17:16379950-16379972 GTCTCACTCTGTCGCCAGACTGG + Intergenic
1144911384 17:18684876-18684898 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1145188574 17:20818257-20818279 GTCTCACTCTGTACCCTGTCTGG - Intergenic
1146212841 17:30955670-30955692 GTCTCACTCTGCACCCAGGCTGG - Intronic
1146283088 17:31558072-31558094 GTCTCACTATGTTCCCAGGCTGG + Intergenic
1146384939 17:32362356-32362378 GTCTCACTTTTTGCCCAGCCTGG + Intronic
1146723770 17:35141522-35141544 GTCTCACTTTGTCGCCAGGCTGG - Intronic
1146747978 17:35348840-35348862 GTCTGATTTTTTTCTCAGACTGG - Intergenic
1146766824 17:35530315-35530337 GTCTCACTCTGTCACCAGACTGG - Intronic
1146852366 17:36233709-36233731 GTCTCACTCTGTCGTCAGGCTGG - Intronic
1146868274 17:36357580-36357602 GTCTCACTCTGTCATCAGGCTGG - Intronic
1146998497 17:37342376-37342398 GTCTTACTTTGTCCACAGCCTGG - Intronic
1147071148 17:37958198-37958220 GTCTCACTCTGTCGTCAGGCTGG - Intergenic
1147082675 17:38037724-38037746 GTCTCACTCTGTCGTCAGGCTGG - Intronic
1147098618 17:38161692-38161714 GTCTCACTCTGTCGTCAGGCTGG - Intergenic
1147320213 17:39641424-39641446 GTCTCACTATGTTGCCAGACTGG - Intronic
1147363412 17:39945140-39945162 GTCTCACTGTGTCAGCAGACTGG + Intergenic
1147671022 17:42176919-42176941 GTCTCACTCTGTGCCCAGGCTGG + Intronic
1147724548 17:42558496-42558518 GTCTCACTCTTTACCCAGGCTGG - Intergenic
1147774448 17:42890755-42890777 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1147803649 17:43113394-43113416 GTCTCACTCTGTTGTCAGGCTGG + Intronic
1147850428 17:43438401-43438423 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1147858421 17:43500879-43500901 GTCTCACTCTGTAGCCAGGCTGG - Intronic
1148111207 17:45145452-45145474 GTCTCGCTTTGTTGTCAGGCTGG + Intergenic
1148112924 17:45156968-45156990 GTCTCACTCTGTCACCAGACTGG - Intergenic
1148133338 17:45275452-45275474 GTCTCACTCTGTCGCCAGACTGG - Intronic
1148173394 17:45543348-45543370 GTCTCACTCTGTTCCCAGACTGG + Intergenic
1148275875 17:46302101-46302123 GTCTCACTCTGTTCCCAGACTGG - Intronic
1148297988 17:46519677-46519699 GTCTCACTCTGTTCCCAGACTGG - Intronic
1148362530 17:47024158-47024180 GTCTCACTCTGTTCCCAGACTGG - Intronic
1148478561 17:47945314-47945336 GTCTCACTTTGGAGTCCGACTGG + Intronic
1148585677 17:48777879-48777901 GTCTCACTCTGTTCCCAGGCTGG - Intronic
1148784954 17:50141462-50141484 TTCTCACTATGTACTCAGGCTGG - Intronic
1148832488 17:50442937-50442959 GTCTCACTCTGTTCCCAGACTGG + Intronic
1148909050 17:50930561-50930583 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1148923447 17:51060874-51060896 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1148925758 17:51083592-51083614 GTCTCACTATGTTGTCAGGCTGG + Intronic
1148938064 17:51181049-51181071 GTCTCACTCTGTCATCAGGCTGG + Intronic
1149170751 17:53808254-53808276 GTCTCGCTTTGTCCCCAGGCTGG - Intergenic
1149224925 17:54458526-54458548 GTCTCACTCTGTCACCAGACTGG - Intergenic
1149233592 17:54565215-54565237 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1149306171 17:55348863-55348885 CTCTCTCTTAGTACTCAGGCTGG - Intergenic
1149676859 17:58472443-58472465 GTCTCACTTTCTCACCAGACTGG - Intronic
1149709364 17:58725960-58725982 GTCTCACTCTGTAACCAGGCTGG - Intronic
1149714124 17:58770884-58770906 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1149783867 17:59419504-59419526 GTCTCACTTTGTCACCAGGCAGG - Intergenic
1149841302 17:59966919-59966941 GTCTCACTCTGTTCCCAGACTGG - Intronic
1149924113 17:60685897-60685919 GTCTCACTCTGTTCCCAGAGTGG + Intronic
1150080158 17:62230718-62230740 GTCTCACTCTGTCGTCAGGCTGG - Intergenic
1150081176 17:62240639-62240661 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1150184856 17:63169782-63169804 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1150331035 17:64294575-64294597 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1150338581 17:64347498-64347520 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1150340263 17:64361014-64361036 GTCTCACTATGTGCTCAGGCTGG + Intronic
1150404601 17:64890263-64890285 GTCTCACTCTGTTCCCAGACTGG + Intronic
1150550196 17:66203147-66203169 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
1150729773 17:67682169-67682191 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1150995679 17:70314920-70314942 ATCTCACTCTGCACTCAGGCTGG + Intergenic
1151038967 17:70835881-70835903 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1151096450 17:71504511-71504533 GTCTCACTCTGTACCCAGGCTGG + Intergenic
1151187229 17:72373247-72373269 GTCTCACTGTGTTGCCAGACTGG - Intergenic
1151468272 17:74301752-74301774 GTCTCATTATGTACCCAGGCTGG - Intronic
1151650983 17:75469372-75469394 GTCTCACTTTGTCGCCCGACTGG + Intronic
1151662731 17:75527137-75527159 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1151787917 17:76284786-76284808 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1151991546 17:77578246-77578268 GTCTCACTTTGTCCCAAGGCTGG + Intergenic
1152168790 17:78729135-78729157 GTCTCACTCTGTACCCAGGCTGG + Intronic
1152843364 17:82584583-82584605 GTCTCACTTTGTCACCAGGCTGG + Intronic
1153557718 18:6333543-6333565 GTCTCACTTTGTCGCCAGGCTGG - Intronic
1153631939 18:7078955-7078977 GTCTCACTCTGTCGTCAGGCTGG - Intronic
1153639508 18:7144501-7144523 GTCTCACTCTGTCGCCAGACTGG - Intergenic
1153700411 18:7687805-7687827 GTCTCACTGTGTCACCAGACTGG + Intronic
1153849397 18:9079175-9079197 GTCTCACTCTGTCATCAGGCTGG + Intergenic
1153853688 18:9123513-9123535 GTCTCACTTTGTCACCAGGCTGG + Intronic
1153977427 18:10281691-10281713 GTCTCACTCTGTTGTCAGACTGG + Intergenic
1154279279 18:12988395-12988417 GTCTCACTTTTTGCCCAGGCTGG + Intergenic
1155129949 18:22924156-22924178 GTCTCACTCTGTCATCAGGCTGG + Intronic
1155150500 18:23119005-23119027 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1155217930 18:23659711-23659733 GTCTCACTCTGTCATCAGGCTGG - Intronic
1155257412 18:24011016-24011038 GTCTCACTCTTTACCCAGGCTGG - Intronic
1155534101 18:26797464-26797486 GTCTCACTCTGTCGTCAGGCTGG - Intergenic
1155633163 18:27919384-27919406 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1155776375 18:29767161-29767183 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1155978809 18:32159820-32159842 GTCTCACTCTGTGCCCAGGCTGG + Intronic
1156281962 18:35647984-35648006 TTCTCACTTTGTACCCAGGCTGG - Intronic
1157169365 18:45388103-45388125 GTCTCACTGTGTGCCCAGGCTGG + Intronic
1157374799 18:47152508-47152530 GTCTCACTGTGTAGCCAGGCTGG + Intronic
1157433202 18:47647133-47647155 GCATAACTTTGTAGTCAGACAGG + Intergenic
1157823632 18:50792507-50792529 GTCTCACTCTGTCACCAGACTGG + Intergenic
1157830306 18:50851437-50851459 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1157850334 18:51042565-51042587 GTCTCACTTTGTTGCCAGGCTGG + Intronic
1157958389 18:52124940-52124962 GTCTCACTTTGTTGCCAGGCCGG - Intergenic
1158088575 18:53683290-53683312 GTCTCACTCTGTCATCAGGCTGG + Intergenic
1158665864 18:59431981-59432003 GTCTCACTCTGTAGCCAGGCTGG + Exonic
1158696877 18:59711317-59711339 GTCTCGCTCTGTCATCAGACTGG - Intergenic
1158952146 18:62504455-62504477 GTCTCACTCTGTTCCCAGGCTGG + Intergenic
1159373125 18:67555278-67555300 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1159429019 18:68327065-68327087 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1160042290 18:75356833-75356855 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1160144795 18:76354952-76354974 GTCTCACTCTGTCATCAGGCTGG + Intergenic
1160288103 18:77565653-77565675 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
1160496108 18:79376722-79376744 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1160695916 19:484464-484486 GTCTCATTCTGTGCTCAGGCTGG + Intergenic
1160702670 19:515706-515728 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1161071792 19:2266014-2266036 GTCTCACTTTGTCACCAGGCTGG - Intronic
1161075821 19:2285212-2285234 GTCTCACTCTGTAGCCAGGCTGG + Intronic
1161180971 19:2881910-2881932 GTCTCACTATGTGCCCAGACTGG - Exonic
1161304923 19:3561985-3562007 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1161351076 19:3792076-3792098 GTCTCACTCTGTTGCCAGACTGG - Intronic
1161368959 19:3898709-3898731 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1161623326 19:5310912-5310934 GTCTCACTTTGTCTCCAGACTGG + Intronic
1161758964 19:6156811-6156833 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1161819212 19:6518984-6519006 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
1161842621 19:6692130-6692152 GTCTCACTCTGTTATCAGCCTGG + Intronic
1162090388 19:8275952-8275974 GTCTCACTATGTTCCCAGGCTGG + Intronic
1162092621 19:8290785-8290807 GTCTCACTATGTTCCCAGGCTGG + Intronic
1162162101 19:8725993-8726015 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
1162176643 19:8834576-8834598 GTCTCGCTCTGTTCTCAGGCTGG - Intronic
1162225210 19:9215311-9215333 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1162290664 19:9777639-9777661 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1162409243 19:10494985-10495007 GTCTCACTCTGTCGTCAGGCTGG + Intronic
1162409435 19:10496464-10496486 GTCTCACTCTGTCATCAGGCTGG - Intronic
1162610399 19:11745530-11745552 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
1162645357 19:12045754-12045776 GTCTCACTCTGTCGTCAGGCTGG + Intronic
1162748633 19:12814064-12814086 GTCTCACTTTGTCACCAGGCTGG + Intronic
1163050738 19:14681703-14681725 GTCTCACTGTGTCCCCAGGCTGG - Intronic
1163065319 19:14788119-14788141 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
1163318777 19:16559621-16559643 GTCTCATTCTGTGCTCAGGCTGG - Intronic
1163441831 19:17325896-17325918 GTCTCGCTTTGTCCCCAGGCTGG - Intronic
1163460359 19:17433744-17433766 GTCTCGCTTTGTGCCCAGGCTGG + Intergenic
1163476643 19:17530289-17530311 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1163808535 19:19415645-19415667 GTCTCACTTTGTCACCAGGCTGG + Intronic
1163851437 19:19666324-19666346 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
1163865850 19:19772765-19772787 GTCTCGCTTTGTAGCCAGACTGG - Intergenic
1163984885 19:20937060-20937082 GTCTCACTCTGTCATCAGGCTGG + Intronic
1164078477 19:21842377-21842399 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1164096390 19:22013545-22013567 GTCTCGCTCTGTTCCCAGACTGG + Intergenic
1164139289 19:22443136-22443158 GTCTCACTCTGTGGTCAGGCTGG + Intronic
1164199572 19:23005604-23005626 GTCTCACTCTGTTCCCAGGCTGG + Intergenic
1164405269 19:27938978-27939000 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
1164432303 19:28198941-28198963 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1164655656 19:29919536-29919558 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
1164974084 19:32558732-32558754 GTTTTACTTTGTCCTCAGTCTGG - Intergenic
1165461781 19:35948220-35948242 GTCTCACTGTGTTCCCATACTGG + Intergenic
1165556236 19:36635047-36635069 GTCTCGCTCTGTTGTCAGACTGG + Intergenic
1165615832 19:37199493-37199515 GTCTCACTCTATCCTCAGGCTGG - Intronic
1165919199 19:39282824-39282846 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1165932270 19:39367536-39367558 GTCTCACTTTGCCCCCAGGCTGG + Intronic
1166013861 19:39965205-39965227 GTCTCACTCTGTTGTCAGGCTGG - Intergenic
1166037710 19:40181171-40181193 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
1166159081 19:40938248-40938270 GTCTCACTCTGTACCCAGGCTGG + Intergenic
1166168028 19:41006180-41006202 GTCTCACTCTGTACCCAGGCTGG + Intronic
1166239999 19:41484244-41484266 GTCTCACTCTGTTGCCAGACTGG - Intergenic
1166559459 19:43722446-43722468 GTCTCACTTTGTCATCAGGATGG + Intergenic
1166576451 19:43843309-43843331 GTCTCACTTTGTCACCAGGCTGG - Intronic
1166599264 19:44079676-44079698 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1166715297 19:44963177-44963199 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1166841519 19:45700069-45700091 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1167179942 19:47895219-47895241 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
1167253757 19:48415339-48415361 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1167310067 19:48732094-48732116 CTCTCACTCTGTCATCAGACTGG + Intronic
1167409148 19:49334850-49334872 GTCTCACTTTTCACCCAGGCTGG - Intergenic
1167485430 19:49760119-49760141 GTCTCACTCTGTAGCCAGGCTGG - Intronic
1167515312 19:49920110-49920132 GTCTCACTCTGTCATCAGGCTGG + Intronic
1167867656 19:52341337-52341359 GTCTCGCTTTGTCATCAGGCTGG + Intronic
1167872097 19:52379043-52379065 GTATCACTCTGTACTAAGGCTGG - Intronic
1167934282 19:52893615-52893637 GTCTCACTTTGTCGACAGGCTGG - Intronic
1168044726 19:53786379-53786401 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1168090508 19:54079972-54079994 GTCTCACTCTGTACCCAGGCTGG - Intronic
1168240210 19:55085193-55085215 GTCTCACTCTGTCATCAGGCTGG + Intronic
1168361134 19:55741657-55741679 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1168592023 19:57644386-57644408 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1168601726 19:57724012-57724034 GTCTCACTCTGTCGCCAGACTGG - Intronic
925649480 2:6074040-6074062 GTCTCACTTTGAAATCATAAGGG + Intergenic
925944655 2:8849824-8849846 GTCTCACTATGTGCCCAGGCTGG + Intergenic
926291021 2:11530535-11530557 GTCTCGCTCTGTCCTCAGGCTGG - Intergenic
926745506 2:16153658-16153680 GTCTCACTATGTTGTCAGGCTGG + Intergenic
927119833 2:19947996-19948018 GTTTCACTATGTTCTCAGTCTGG + Intronic
927471131 2:23378005-23378027 GTCTCACTCTGTGCCCAGCCTGG - Intergenic
927595614 2:24394377-24394399 GTCTCACTCTTTGCCCAGACTGG + Intergenic
927770385 2:25856084-25856106 GTCTCACTTTGTCGCCAGGCTGG + Intronic
927772237 2:25873379-25873401 GTCTCACTCTGTCGTCAGTCTGG - Intronic
928068346 2:28189169-28189191 GTCTCACTCTGTCGCCAGACTGG - Intronic
928703487 2:33923104-33923126 GTCTCACTCTGTCACCAGACTGG + Intergenic
928788295 2:34917459-34917481 GTCTCACTCTGTCACCAGACTGG - Intergenic
928956433 2:36873911-36873933 GTCTCGCTTTGTCGCCAGACTGG - Intronic
928969180 2:37009226-37009248 GTCTCACTTTGTCACCAGGCTGG - Intronic
929186370 2:39099766-39099788 GTCTCACTCTGTGCCCAGGCTGG + Intronic
929193949 2:39165945-39165967 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
929489374 2:42382793-42382815 GTCTCACTCTGTTCCCAGGCTGG + Intronic
929724288 2:44408053-44408075 GTCTCACTCTGTCCCCAGGCTGG + Intronic
929932775 2:46271714-46271736 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
930145115 2:47994294-47994316 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
930375895 2:50566271-50566293 GTCTCACTCTGCACCCAGGCTGG + Intronic
930628102 2:53721086-53721108 GTCTTGCTCTGTACCCAGACTGG - Intronic
930662846 2:54072333-54072355 GTCTCACTCTATACCCAGGCTGG + Intronic
930728436 2:54705693-54705715 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
930820332 2:55640181-55640203 GTCTCACTCTGTCGCCAGACTGG + Intronic
931309151 2:61062127-61062149 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
931326903 2:61235353-61235375 GTCTCACTGTGTCGTCAGGCTGG + Intronic
931587541 2:63844589-63844611 GTCTCACTTTGTTGCCAGGCTGG + Intronic
931734210 2:65179205-65179227 GTCTCACTCTATCCCCAGACTGG - Intergenic
931763074 2:65433192-65433214 GTCTCGCTCTGTCCTCAGGCTGG + Intergenic
932156645 2:69424140-69424162 GTCTCACTTTGTCACCAGGCTGG - Intronic
932252076 2:70253262-70253284 GTCTCACTCTGTGCCCAGACTGG + Intergenic
932519344 2:72393122-72393144 GTCTCACTCTGTAACCAGGCTGG + Intronic
932889694 2:75581276-75581298 GTCTCACTCTGTTGACAGACTGG - Intergenic
933384008 2:81587341-81587363 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
933581406 2:84130689-84130711 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
933674809 2:85045208-85045230 GTCTCACTTTGTTGCCAGGCTGG - Intronic
933796347 2:85923031-85923053 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
934485260 2:94701977-94701999 GTCTCACTCTGTATCCAGGCTGG - Intergenic
934547281 2:95228398-95228420 GTCTCACTCTGTTCCCAGGCTGG - Intronic
934748980 2:96779830-96779852 GTCTCACTTTGTCTCCAGGCCGG + Intronic
934782275 2:96978652-96978674 GTCTCACTTTGTCACCAGGCTGG + Intronic
934954220 2:98603449-98603471 GTCTCACTTTGTCACCAGGCTGG - Intronic
935042551 2:99447184-99447206 GTCTCACTTTGTCGCCAGGCTGG + Intronic
935073910 2:99721497-99721519 GTCTCACTCTGTCCCCAGGCTGG - Intronic
935168943 2:100595109-100595131 GTCTCACTCTGTCGCCAGACTGG + Intergenic
935172506 2:100621323-100621345 GTCTCACTTCATACTCAGAGAGG + Intergenic
935264213 2:101380912-101380934 GTCTCACTCTGTCATCAGGCTGG - Intronic
935332183 2:101985394-101985416 GTCCCACCTGGTACTCAGAGGGG - Intergenic
935442611 2:103119040-103119062 GTCTCACTTTGTCACCAGGCTGG - Intergenic
935844190 2:107146883-107146905 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
935948436 2:108306874-108306896 GTCTCACTTTGTCACCAGGCTGG - Intronic
935998074 2:108796076-108796098 GTCTCACTCTGTGCCCAGGCTGG + Intronic
936408297 2:112228470-112228492 GTCTCACTCTGTTGCCAGACTGG - Intronic
936561740 2:113544666-113544688 GTCTCACTTTGTGCCCAGGCTGG + Intergenic
936580230 2:113693885-113693907 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
936620495 2:114091758-114091780 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
936982233 2:118275634-118275656 GTCTCACTTTGTCTCCAGGCTGG + Intergenic
937101218 2:119271536-119271558 GTCTCACTTTGTCACCAGGCTGG + Intergenic
937148751 2:119671227-119671249 TTAGCACTTTGGACTCAGACTGG + Intergenic
937936570 2:127250019-127250041 TCCTTACTTTGTACTGAGACAGG - Intergenic
938004040 2:127772926-127772948 GTCTCACTATGTGCACAGGCTGG - Intronic
938284059 2:130093159-130093181 GTCTCACTTTGCCCCCAGAAGGG + Intronic
938334704 2:130481724-130481746 GTCTCACTTTGCCCCCAGAAGGG + Intronic
938355117 2:130638946-130638968 GTCTCACTTTGCCCCCAGAAGGG - Intronic
938431548 2:131245734-131245756 GTCTCACTTTGCCCCCAGAAGGG - Intronic
938466221 2:131527460-131527482 GTCTCACTTTCCATTCAGGCTGG + Intergenic
938589238 2:132720983-132721005 GTCTCACTGTGTACCTAGGCTGG - Intronic
938804612 2:134794817-134794839 GTCTCACTTGTTACCCAGGCTGG + Intergenic
938970603 2:136427947-136427969 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
939671659 2:145019752-145019774 GTCTCACTCCGTAGCCAGACTGG - Intergenic
939690752 2:145257327-145257349 GTCTCACTGTGTACACAGCTTGG + Intergenic
939741340 2:145911091-145911113 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
940329283 2:152456906-152456928 GTCTCACTCTGTCATCAGGCTGG - Intronic
940532605 2:154898217-154898239 GTCTCACTCTGTCCCCAGACTGG - Intergenic
940845060 2:158631584-158631606 GTCTCACTCTGTTCCCAGACTGG + Intronic
940961209 2:159788075-159788097 GTCTCACTCTGTTGTCAGGCTGG - Intronic
941493715 2:166174837-166174859 GTATCACTTTGTCATCAGAAAGG - Intergenic
941499121 2:166247544-166247566 GTCTCACTTTGTTGCCAGGCTGG + Intronic
941511363 2:166415252-166415274 GTCACACTTTGTCACCAGACTGG + Intronic
941708698 2:168688385-168688407 GTCTCACTTTGTCGCCAGGCTGG - Intronic
941813242 2:169775111-169775133 GTCTCGCTTTGTCCCCAGGCTGG + Intronic
941834672 2:170003668-170003690 GTCTCACTCTGTGCCCAGGCTGG + Intronic
941869226 2:170366328-170366350 GTCTCACTCTGTTGCCAGACTGG + Intronic
941895145 2:170621537-170621559 GTCTCACTCTGTGCCCAGGCTGG + Intronic
942780759 2:179639196-179639218 ATCTCACTCTGTCCCCAGACTGG - Intronic
943042614 2:182821194-182821216 GTCTCACTCTGTCGCCAGACTGG - Intergenic
943565093 2:189507600-189507622 GTCTCACTCTGTTCCCAGGCTGG - Intergenic
943617285 2:190108183-190108205 GTCTCACTCTGTCCCCAGGCTGG + Intronic
944258999 2:197655792-197655814 GTCTCACTCTGTTCCCAGGCTGG - Intronic
944313756 2:198263904-198263926 GTCTCACTCTGTCCCCAGGCTGG + Intronic
944313853 2:198264594-198264616 GTCTCACTCTATCCTCAGGCTGG - Intronic
944749486 2:202694218-202694240 GTCTCACTCTGTCGCCAGACTGG + Intronic
944805840 2:203280377-203280399 GTCTCACTCTGTTTTCAGGCTGG - Intronic
944860770 2:203813880-203813902 GTCTCACTTTGAACTATCACAGG - Intergenic
945058276 2:205886720-205886742 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
945078829 2:206068126-206068148 GTCTCACTTTGTTGCCAGGCTGG + Intronic
945319861 2:208408654-208408676 GTCTCACTTTGTTGCCAGGCTGG - Intronic
945377874 2:209100369-209100391 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
945453167 2:210017037-210017059 GTCTCACTACGTACCCAGGCTGG + Intronic
945459195 2:210084641-210084663 GTCTCACTTTGTCGCCAGGCTGG + Intronic
945595443 2:211785129-211785151 GTCTCACTCTGTCCCCAGGCTGG + Intronic
945717365 2:213375552-213375574 CCTTCACTTTGTAATCAGACTGG + Intronic
945953936 2:216067584-216067606 GTCTCACTCTGTCGCCAGACTGG + Intronic
946096733 2:217281044-217281066 GTCTCGCTCTGTCCCCAGACTGG - Intergenic
946238160 2:218338115-218338137 GTCTCACTCTGTCGTCAGGCAGG - Intronic
946314544 2:218901683-218901705 GTCTCACTTTTTGCCCAGCCTGG + Intergenic
946334141 2:219026254-219026276 GTCTGACATTGGACACAGACAGG + Intronic
946746112 2:222847537-222847559 GTCTCACTTTGTCACCAGGCTGG - Intergenic
946779099 2:223174432-223174454 GTCTCACTCTGTCCCCAGTCTGG - Intronic
946906350 2:224420195-224420217 GTCTCACTTTTTGCTCAGGCTGG - Intergenic
946952480 2:224892367-224892389 GTCTCACTTCGTCCCCAGGCTGG - Intronic
947051449 2:226048268-226048290 GTCTCACTCTGTCATCAGGCTGG - Intergenic
947164729 2:227250281-227250303 GTCTCATTCTGTCCTCAGGCTGG - Intronic
947192081 2:227517293-227517315 GTCTCACTCTGTCATCAGGCTGG + Intronic
947496435 2:230641076-230641098 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
947543480 2:230994369-230994391 GTCTCACTCTGTCGTCAGGCTGG + Intergenic
947627499 2:231629416-231629438 GTCTCCCTGTGTACCCAGGCTGG - Intergenic
947898221 2:233695153-233695175 GTCTCACTCTGTCATCAGGCTGG + Intronic
948288639 2:236807702-236807724 GTCTCACTTTGTCACCAGGCTGG - Intergenic
948296894 2:236867398-236867420 ATCTCACTTTGTCCTCATATGGG + Intergenic
948494183 2:238335827-238335849 GTCTCACTCTGTTGCCAGACTGG + Intronic
948713764 2:239844756-239844778 GTCTCACTCTGTCACCAGACTGG - Intergenic
948829112 2:240589038-240589060 GTTTCACTTTTTACTCATGCTGG - Intronic
1168873703 20:1154574-1154596 GGCTGAATTTGTACTCTGACTGG + Intronic
1169450784 20:5709177-5709199 GTCTCACTCTGTTTCCAGACTGG + Intergenic
1169462038 20:5803840-5803862 GTCTCACTCTGTCATCAGGCTGG - Intronic
1169555983 20:6750387-6750409 GTCTCACTCTGTCCTCAGGCTGG - Intergenic
1170233248 20:14073304-14073326 GTCTCACTCTGTCACCAGACTGG - Intronic
1170819946 20:19748413-19748435 GTCTCACTCTGTCACCAGACTGG - Intergenic
1170859636 20:20090658-20090680 GTCTCACTCTGTTGCCAGACTGG - Intronic
1170927382 20:20737872-20737894 GTCTCACTCTGTCCCCAGGCAGG + Intergenic
1171095018 20:22324606-22324628 GTCTTACATCGTACTCAAACAGG + Intergenic
1171483487 20:25470091-25470113 TTCTCAATTTTTACGCAGACTGG - Exonic
1171757351 20:29123195-29123217 GTCTCGCTCTGTCCCCAGACTGG + Intergenic
1172078910 20:32323427-32323449 GTCTCACTTTGTCGCCAGACTGG + Intronic
1172254086 20:33501667-33501689 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1172265825 20:33612888-33612910 GTCTCACTATGTACCCAGGCTGG - Intronic
1172301692 20:33854997-33855019 GTCTCATTTTGAACTCAGGTTGG - Intergenic
1172400700 20:34648895-34648917 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1172529823 20:35622390-35622412 GTCTCACTCTGTCGCCAGACTGG - Intergenic
1172570664 20:35967821-35967843 GTCTCACTTTGTTCCCAGGATGG - Intronic
1172571951 20:35977472-35977494 GTCTCACATGTTGCTCAGACTGG - Intronic
1172680451 20:36710292-36710314 ATCTCACTTTGCACCCAGGCTGG - Intronic
1172967440 20:38847384-38847406 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1173238511 20:41271048-41271070 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1173474798 20:43351466-43351488 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1173510942 20:43627954-43627976 GTCTCACTCTTTACCCAGGCTGG + Intronic
1173608796 20:44351570-44351592 GTCTCACTCTGTCCTCAGGCTGG - Intergenic
1173639362 20:44589305-44589327 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1174026541 20:47581073-47581095 ATCTCACTCTGTGCCCAGACTGG - Intronic
1174047413 20:47743336-47743358 GTCTCACTCTGTACCCAGGCTGG + Intronic
1174175715 20:48643437-48643459 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1174234264 20:49075859-49075881 GTCTCACTTTGTCACCAGGCTGG + Intronic
1174237348 20:49104781-49104803 GTCTCACTGTGTACCCAGGCTGG - Intergenic
1174345615 20:49927235-49927257 GTCTCACTTTGTTCCCAGGCTGG - Intergenic
1174702795 20:52625899-52625921 GTCTCACTCTGTTGTCAGGCTGG - Intergenic
1174778064 20:53363781-53363803 GTCTCGCTTGTTACTCAGGCTGG - Intronic
1174799330 20:53550028-53550050 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1174956933 20:55108027-55108049 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1175738631 20:61405018-61405040 ATCTTACTCTGTACTCAGGCTGG - Intronic
1176387213 21:6144413-6144435 GTCTCACTCTGTTGCCAGACTGG + Intergenic
1176390541 21:6160921-6160943 GTCTCACTCTGTCGTCAGGCTGG - Intergenic
1177168518 21:17629533-17629555 GTCTCACTCTGTTCCCAGGCTGG - Intergenic
1177482155 21:21704949-21704971 GTCTCACTTTGTCATCAGGCTGG + Intergenic
1177509637 21:22068434-22068456 GTCTCACTCTGTTGCCAGACTGG - Intergenic
1177604137 21:23356992-23357014 GTTTCACTATGTTGTCAGACTGG + Intergenic
1177622256 21:23611472-23611494 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
1177654558 21:24000855-24000877 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1177745013 21:25201601-25201623 GTCTCGCTCTGTAACCAGACTGG - Intergenic
1178096391 21:29220101-29220123 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1178122383 21:29482401-29482423 GTCTCGCTCTGTCCCCAGACTGG + Intronic
1178168390 21:30008787-30008809 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1178316865 21:31574140-31574162 GTCTCACTCTGTTGCCAGACTGG - Intergenic
1178445774 21:32640324-32640346 GTCTCACTCTGTGGCCAGACGGG + Intronic
1178813671 21:35907453-35907475 GTCTCACTCTGTCCTCAGGCTGG - Intronic
1178852180 21:36221899-36221921 GTCTCGCTCTGTACCCAGCCTGG + Intronic
1179067052 21:38034779-38034801 GTCTTACTCTGTACCCAGGCTGG - Intronic
1179261330 21:39760598-39760620 GTCTCACTCTGTCGTCAGGCTGG + Intronic
1179736260 21:43393835-43393857 GTCTCACTCTGTTGCCAGACTGG - Intergenic
1180691927 22:17723901-17723923 GTCTCACTCTGTCATCAGGCTGG - Intronic
1180798241 22:18618243-18618265 GTCTCACTTTGTCGCCAGGCTGG - Intergenic
1180888005 22:19262053-19262075 GTCTCACTCTGTTGCCAGACTGG + Intronic
1181100915 22:20538277-20538299 GTCTCACTCTGTACCCAGGCTGG + Intronic
1181180372 22:21063641-21063663 GTCTCGCTGTGTACCCAGGCTGG - Intronic
1181223477 22:21377023-21377045 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1181255264 22:21558599-21558621 GTCTCACTTTGTCGCCAGGCTGG - Intronic
1181270588 22:21656345-21656367 GTCTCACTTTGTCGCCAGGCTGG - Intronic
1181271739 22:21662766-21662788 GTCTCACTTTGTCGCCAGGCTGG - Intronic
1181476494 22:23170995-23171017 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1181676437 22:24456757-24456779 GTCTCACTCTGCACCCAGGCTGG - Intergenic
1181858313 22:25798758-25798780 GTCTCACTTTTTGCCCAGGCTGG + Intronic
1182090394 22:27590797-27590819 GTCTCGCTCTGTACCCAGGCTGG + Intergenic
1182213825 22:28699393-28699415 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1182252292 22:29010697-29010719 GTCTCACTCTGCACCCAGGCTGG + Intronic
1182910901 22:33983416-33983438 GTTTCACTCTGCACTCAGGCAGG + Intergenic
1182977359 22:34635918-34635940 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1183183410 22:36277266-36277288 GTCTCGCTTTGTAGCCAGGCTGG - Intergenic
1183230241 22:36577618-36577640 GTCTCACTCTGTCGCCAGACTGG - Intronic
1183265441 22:36822346-36822368 GTCTCACTCTGTCACCAGACTGG - Intergenic
1183568443 22:38633569-38633591 GTCTCACTATATCCCCAGACTGG + Intronic
1183568768 22:38635959-38635981 GTCTCCCTCTGTACCCAGGCTGG - Intronic
1183826586 22:40393144-40393166 GTCTCACTTTGTTGCCAGGCTGG + Intronic
1183878924 22:40809600-40809622 GTCTCACTGTGTACCCAGGCTGG - Intronic
1183982058 22:41546857-41546879 GTCTCACTTTGTCGCCAGGCTGG - Intergenic
1183996655 22:41638746-41638768 GTCTCACTTTGTCACCAGGCTGG - Intronic
1184232453 22:43165920-43165942 GTCTCACTCTGTCGTCAGGCTGG + Intergenic
1184672204 22:46019982-46020004 GTCTCACTTTTTGCCCAGGCAGG - Intergenic
949321581 3:2816789-2816811 GTCTCACTCTGTTGCCAGACTGG - Intronic
949694204 3:6675221-6675243 GTCTCACTCTGTCACCAGACTGG - Intergenic
949767412 3:7542575-7542597 GTCTCACTCTGTCGCCAGACTGG + Intronic
950239412 3:11354617-11354639 GTCTCACTCTGTGACCAGACTGG - Intronic
951221184 3:20070332-20070354 GTCTCGCTCTGTACCCAGGCTGG + Intronic
951529448 3:23685102-23685124 GTCTCACTCTGTCATCAGGCTGG + Intergenic
951697799 3:25463631-25463653 GTCTCACTCTGTCGTCAGGCTGG - Intronic
951890238 3:27561521-27561543 GTCTCACTCTGTCATCAGGCTGG - Intergenic
952014371 3:28939600-28939622 GTCTCACTGTGTAGCCAGGCTGG + Intergenic
952335178 3:32397702-32397724 GTCTCACTTTGTTGCCAGGCTGG - Intronic
952358833 3:32609851-32609873 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
952445877 3:33380193-33380215 GTCTCACTCTGTCGCCAGACTGG - Intronic
953103466 3:39852808-39852830 GTCTCACTCTGTTGCCAGACTGG + Intronic
953317319 3:41941061-41941083 GTCTCACTCTATACCCAGGCTGG + Intronic
953963993 3:47288189-47288211 GTCTCACTCTGTCCCCAGGCTGG - Intronic
953988666 3:47466101-47466123 GTCTCACTCTGTTGTCAGGCTGG - Intronic
954006156 3:47592621-47592643 GTCTCATTTTCTACTCAGTTTGG + Intronic
954180851 3:48880310-48880332 GTCTCACTCTGTCCCCAGGCTGG + Intronic
954208986 3:49083174-49083196 GTCTCACTTTGTCGCCAGGCTGG - Intronic
954220225 3:49148987-49149009 GTCTCACTTTGTCACCAGGCTGG - Intergenic
954255593 3:49403517-49403539 GTCTCACTATGTGCTCAGACTGG - Intronic
954487563 3:50868101-50868123 GTCTCACTCTGTCGCCAGACTGG + Intronic
954557371 3:51528692-51528714 GTCTCACTATGTGCCCAGGCTGG - Intergenic
955292281 3:57703338-57703360 GTCTCACTTGTTGCTCAGGCTGG + Intergenic
955396324 3:58560267-58560289 TTCTCACTGTGTCCTCACACTGG - Intergenic
955683382 3:61525900-61525922 GTCTCACTATGTTGTCAGGCTGG + Intergenic
955685321 3:61543463-61543485 GTCTCACTTTATGCCCAGCCTGG - Intergenic
955764388 3:62325992-62326014 GTCTCACTCTGTCCCCAGGCTGG - Intronic
956363938 3:68479199-68479221 GTCTCACTTTGTCACCAGGCTGG - Intronic
956373345 3:68587903-68587925 GTCTCACTCTGTCACCAGACTGG + Intergenic
956401413 3:68883901-68883923 GTCTCACTCTTTGCTCAGGCTGG - Intronic
956607305 3:71085757-71085779 GTCTCACTGTGTTGCCAGACTGG + Intronic
956997183 3:74840855-74840877 GTCTCACTCTGTTGCCAGACTGG + Intergenic
957058678 3:75463604-75463626 GTCTCACTCTGTCACCAGACTGG - Intergenic
957177565 3:76830957-76830979 GTCTCACTGTGCACCCAGGCTGG - Intronic
957285514 3:78212483-78212505 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
957310289 3:78510164-78510186 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
957517281 3:81272305-81272327 GTCTCACTCTGTTGCCAGACTGG + Intergenic
957651824 3:83016512-83016534 GTCTCATCATGTACTCAGTCTGG + Intergenic
957720165 3:83985282-83985304 GTCTCACTCTGTAGTCAGACTGG + Intergenic
957725061 3:84053660-84053682 ATCTCACTTTGTTCCCAGACTGG + Intergenic
957767957 3:84650017-84650039 GTCTCACTCTGTTGTCAGGCTGG - Intergenic
957957809 3:87210936-87210958 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
957979013 3:87483892-87483914 GTCTCACTATCTACCCAGGCTGG + Intergenic
958524041 3:95228914-95228936 GTCTCGCTCTGTACCCAGGCTGG - Intergenic
958674480 3:97250894-97250916 GTCTCACTTTGTCCCCAGGGTGG + Intronic
958938315 3:100282280-100282302 GTCTCACTCTGTGCCCAGGCTGG - Intronic
959034301 3:101342694-101342716 GTCTCACTCTGTAGCCAGGCTGG + Intronic
959323606 3:104908492-104908514 GTCTCACTCTGTCCTCAGGCTGG - Intergenic
959335386 3:105057966-105057988 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
959445914 3:106439513-106439535 GTCTCACTCTGTCGTCAGGCTGG + Intergenic
959554940 3:107706050-107706072 GTCTCACTCTGTAGCCAGACTGG + Intronic
959692210 3:109209815-109209837 GTCTCTCTCTGCACCCAGACTGG - Intergenic
959747176 3:109790263-109790285 GTCTCACTCTGTCATCAGGCTGG - Intergenic
960200798 3:114833728-114833750 TTCTCACTATGTTGTCAGACTGG + Intronic
960679511 3:120232762-120232784 GTCTCACTCTGTGCCCAGGCTGG + Intronic
960803861 3:121564278-121564300 GTCTCACTTTGTCACCAGGCTGG + Intergenic
960819028 3:121707195-121707217 GTCTCACTTTGTCACCAGGCTGG - Intronic
960855301 3:122096271-122096293 GTCTCGCTTTGTGCCCAGGCTGG + Intronic
960881368 3:122348593-122348615 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
961294773 3:125876092-125876114 GTCTCACTCTGTCACCAGACTGG + Intergenic
961866913 3:129960081-129960103 GTCTCACTATGTGCCCAGGCTGG + Intergenic
962011186 3:131392500-131392522 GTCTCACTTTGTCACCAGGCTGG + Intergenic
962444077 3:135449426-135449448 GGCTCACTTCCTACTCAGGCTGG - Intergenic
962779798 3:138701754-138701776 GTCTCACTCTGTTGTCAGGCTGG - Intronic
963145372 3:141988696-141988718 GTCTCACTCTGTCGTCAGGCTGG + Intronic
963218365 3:142776871-142776893 GTCTCACTCTGTCACCAGACCGG - Intronic
963227682 3:142878822-142878844 GTCTCACTTTTCACCCAGTCTGG - Intronic
963308125 3:143676705-143676727 GTCTCACTCTGTCCCCAGGCTGG - Intronic
963340744 3:144029476-144029498 GTCTCACTCTGTACCCAGGCTGG + Intronic
963698838 3:148598348-148598370 GTTTCACTATGTTCTCAGGCTGG - Intergenic
963936512 3:151059651-151059673 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
964058710 3:152494222-152494244 GTCTCACTTTGTCGCCAGGCTGG - Intergenic
964102698 3:153006185-153006207 GTCTCACTCTGTCACCAGACTGG + Intergenic
964334700 3:155642976-155642998 GTCTCACTTTGTCACCAGGCTGG + Intronic
964832977 3:160906570-160906592 GTCTCACTCTGTTGTCAGGCTGG - Intronic
965107561 3:164376739-164376761 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
965250479 3:166337082-166337104 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
965468605 3:169062962-169062984 GTCTCACTTTGTCACCAGGCTGG + Intergenic
965616712 3:170601260-170601282 GTCTCGCTTTGTAGCCAGGCTGG + Intronic
966107116 3:176349557-176349579 GTCTCACTCTGTTGCCAGACTGG + Intergenic
966172271 3:177095518-177095540 GTCTCACTTGTCACCCAGACTGG + Intronic
966603237 3:181796011-181796033 GTCTTACTTTGTTCCCAGGCTGG - Intergenic
966718847 3:183040691-183040713 GTCTCACTCTGTGCCCAGGCTGG - Intronic
966727166 3:183118201-183118223 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
966812256 3:183857217-183857239 GTCTCACTTGTCACTCAGGCTGG - Intronic
967076644 3:186009282-186009304 GTCTCACTCTGTCACCAGACTGG + Intergenic
967155418 3:186687203-186687225 GTCTCACTTTGTCGCCAGACTGG - Intergenic
967591850 3:191285867-191285889 GTCTCACTCTGTCATCAGGCTGG - Intronic
967683193 3:192389331-192389353 GTCTCACTCTGTAGCCAGGCTGG - Intronic
967902454 3:194469429-194469451 GTCTCACTCTGTTCCCAGGCCGG - Intronic
968179479 3:196581258-196581280 GTCTCACTCTGTCGTCAGGCTGG + Intronic
968187738 3:196644741-196644763 GTCTCACTCTGTCGCCAGACTGG - Intronic
968194740 3:196696822-196696844 GTCTCACTTTTTGCCCACACTGG + Intronic
968297242 3:197586114-197586136 GTCTCACTATGTACCTAGGCTGG + Intergenic
968338315 3:197932601-197932623 GTCTCACTCTGTTGCCAGACTGG - Intronic
968465717 4:749507-749529 GTCTCACTTTGTCGCCAGGCTGG + Intronic
968732953 4:2279749-2279771 GTCTCACTCTGTTGTCAGGCTGG - Intronic
969248113 4:5948762-5948784 GTCTCACTTTGTCACCAGGCTGG - Intronic
969685071 4:8666978-8667000 GTCTCACTCTGTCTTCAGGCTGG + Intergenic
970094268 4:12444985-12445007 GTCTCACTCTGTCATCAGGCTGG + Intergenic
970415875 4:15856452-15856474 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
970775937 4:19674399-19674421 GTCTCACTCTGTCATCAGGCTGG + Intergenic
971121958 4:23714569-23714591 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
971273870 4:25176912-25176934 GTCTCACTTTGTCACCAGGCTGG + Intronic
971298935 4:25426023-25426045 GTCTCACTTTGTCACCAGGCTGG + Intergenic
972129928 4:35819741-35819763 TTCTCTCTCTGTACTCAGGCTGG - Intergenic
972523302 4:39883208-39883230 GTCTCACTTTTTGCCCAGGCTGG + Intronic
972545018 4:40072273-40072295 GTCTCACTTTGTCGCCAGGCTGG + Intronic
972618803 4:40725783-40725805 GTCTCACTCTGTCCCCGGACTGG - Intergenic
973043856 4:45510262-45510284 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
973318927 4:48790197-48790219 GTCTCCCTTTGTGCCCAGGCTGG + Intergenic
973610488 4:52631974-52631996 GTCTCATTCTGTACCCAGGCTGG - Intronic
973917468 4:55650340-55650362 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
974197084 4:58589015-58589037 GTCTCACTTTGTCGCCAGGCTGG - Intergenic
974595114 4:64004254-64004276 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
974861503 4:67527528-67527550 GTCTGACTCTGTACCCAGGCTGG + Intronic
974910151 4:68107905-68107927 GTCTCACTTTGTCTCCAGGCTGG - Intronic
975333638 4:73149833-73149855 GTCTCACTCTGTTCCCAGGCTGG - Intronic
975568355 4:75784758-75784780 GTCTCACTCTGTTCCCAGGCTGG - Intronic
975568983 4:75792665-75792687 GTCTCACTGTTTGCCCAGACTGG - Intronic
975939435 4:79624411-79624433 GTCTCATTTTGCACTCAAATTGG - Intergenic
976059289 4:81107540-81107562 GTCTCACTCTGTCATCAGGCTGG + Intronic
976184715 4:82431938-82431960 GTCTCACTCTGTTCCCAGGCTGG + Intronic
976462563 4:85329710-85329732 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
976633773 4:87266686-87266708 GTCTCACTCTGTTCCCAGGCTGG - Intergenic
976764346 4:88583409-88583431 GTCTCACTCTGTATCCAGGCTGG - Intronic
976965788 4:91039056-91039078 GTCTCACTCTGCACCCAGGCTGG + Intronic
977050877 4:92127874-92127896 GTCTTACTGTTTCCTCAGACTGG - Intergenic
977228809 4:94427211-94427233 GTCTTACTTTATGCTCAGGCTGG - Intergenic
977236708 4:94516551-94516573 GTCTCACTTGTTACCCAGGCTGG + Intronic
977279010 4:95015720-95015742 GTCTCACTCTGTCACCAGACTGG + Intronic
977599357 4:98919273-98919295 GTCTCACTCTGTTGTCAGGCTGG - Intronic
977603258 4:98956571-98956593 GTCTCACTCTGTCATCAGGCTGG - Intergenic
978008093 4:103643393-103643415 GTCTCACTCTGTCGCCAGACTGG - Intronic
978506312 4:109461911-109461933 GTCTCACTGTGTGCCCAGGCTGG - Intronic
979219895 4:118210744-118210766 GTCTCACTTTGTCACCAGGCTGG - Intronic
979250727 4:118564361-118564383 GTCTCACTCTGTCGCCAGACTGG + Intergenic
979526481 4:121722748-121722770 GTCTCGCTCTGTACCCAGGCTGG - Intergenic
979683719 4:123488230-123488252 GTCTCACTTTGTCACCAGGCTGG + Intergenic
980022584 4:127727481-127727503 GTCTCACTCTGCACCCAGACTGG - Intergenic
980038279 4:127910189-127910211 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
980108620 4:128613049-128613071 GTCTCACTCTGTTGCCAGACTGG - Intergenic
980221512 4:129923182-129923204 GTCTCACTCTGTCACCAGACTGG + Intergenic
980256248 4:130383489-130383511 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
980301462 4:130999790-130999812 GTCTCACTCTGCACCCAGGCTGG + Intergenic
980344868 4:131600975-131600997 GTCTCACCTTGTGCCCAGGCTGG - Intergenic
980669122 4:135981139-135981161 GTCTTACTCTGTACCCAGGCTGG + Intergenic
980736827 4:136900711-136900733 GTCTCACTTTGTCGCCAGGCTGG - Intergenic
981036359 4:140173591-140173613 GTCTCACTTGTTGCCCAGACTGG - Intergenic
981311704 4:143303955-143303977 GTTTCACTCTGTGCTCAGGCGGG - Intergenic
981818972 4:148864180-148864202 GTCTCACTGTGTTCCCAGGCTGG - Intergenic
981941346 4:150284719-150284741 GTCTCACTATGTTGCCAGACTGG + Intronic
983365115 4:166776381-166776403 GTCTCACTCTGTCACCAGACTGG - Intronic
984220183 4:176965199-176965221 GTCTCACTCTGTTCCCAGGCTGG + Intergenic
984267311 4:177510426-177510448 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
984406929 4:179344414-179344436 GTCTCACTCTGTCCCCAGCCTGG - Intergenic
984532243 4:180931001-180931023 GTCTCATTTTGTAGCCAGGCTGG - Intergenic
984656747 4:182326736-182326758 GTCTCGCTTGTTCCTCAGACTGG + Intronic
984782641 4:183539727-183539749 GTCTCACTATGTGCCCAGGCTGG - Intergenic
985252466 4:188037958-188037980 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
986577911 5:9231435-9231457 GTCTTGCTCTGTACTCAGGCTGG - Intronic
986699226 5:10389429-10389451 GTCTCACTCTGTACCCATGCTGG + Intronic
986985115 5:13492298-13492320 GTCTCACTCTGTCCCCAGGCAGG - Intergenic
987330196 5:16850301-16850323 GTCTCACTCTGTTGTCAGGCTGG + Intronic
987446233 5:18023021-18023043 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
987503040 5:18737691-18737713 GTCTCACTCTGTCCTCAGGCTGG + Intergenic
988006324 5:25416500-25416522 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
988126009 5:27038603-27038625 GCATCACTTTTAACTCAGACAGG + Intronic
988569026 5:32345387-32345409 GTCTCACTTTGTCACCAGGCTGG - Intergenic
988582851 5:32483509-32483531 GTCTCACTCTGTCATCAGGCTGG + Intergenic
989060543 5:37407130-37407152 GTCTCACTCTGTCCCCAGGCTGG - Intronic
989301246 5:39896544-39896566 GTCTCACTCTGTCATCAGGCTGG + Intergenic
989595349 5:43151462-43151484 GTCTCACTCTGTGCCCAGGCTGG + Intronic
990386331 5:55266808-55266830 GTCTCACTATGTGCCCAGGCTGG + Intronic
990457240 5:55999807-55999829 GTCTCACTTTGTCACCAGGCTGG - Intergenic
990475592 5:56159039-56159061 GTCTCACTTTGTTGCCAGGCTGG + Intronic
990572495 5:57093422-57093444 GTCTCACTCTGTCGTCAGGCTGG - Intergenic
990576135 5:57125268-57125290 GTCTCACTCTGTCATCAGGCTGG + Intergenic
990733852 5:58838348-58838370 GTCTCACTCTGTCCCCAGGCTGG - Intronic
991101517 5:62798479-62798501 GTCTCACTCTGTCATCAGGCTGG - Intergenic
991362946 5:65839946-65839968 GTCTCACTCTGTCCCCAGACTGG - Intronic
991423462 5:66465575-66465597 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
991481204 5:67082176-67082198 GTCTCACTCTGTCGTCAGGCTGG + Intronic
991685523 5:69178922-69178944 GTCTCACTCTGTCGTCAGGCTGG + Intergenic
991771090 5:70041950-70041972 GTCTCACTCTGTCACCAGACTGG + Exonic
991850382 5:70917367-70917389 GTCTCACTCTGTCACCAGACTGG + Exonic
991906184 5:71513747-71513769 GTCTCACTCTGTTCCCAGGCTGG + Intronic
992593866 5:78325656-78325678 GTCTCACTTTGTCACCAGGCTGG - Intergenic
992787148 5:80181274-80181296 GTCTCACTCTGTACCCAGGCTGG + Intronic
992805633 5:80334657-80334679 GTCTCACTTTGTCATCCAACTGG - Intergenic
993556556 5:89347067-89347089 GTCTCACTTTTTACCCAGGCTGG + Intergenic
993616414 5:90117754-90117776 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
993720199 5:91314725-91314747 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
995225505 5:109696128-109696150 GTCTCACTATGTTGGCAGACTGG + Intronic
995229133 5:109738871-109738893 GTCCCACTCTGTTCTCAGGCTGG + Intronic
995274856 5:110266649-110266671 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
995350014 5:111164253-111164275 GTCTCACTTCTTGCCCAGACTGG - Intergenic
995704378 5:114971156-114971178 GTCTCACTGTGTCCCCAGGCTGG - Intergenic
995757773 5:115527969-115527991 GTCTCACTTTGTCACCAGGCTGG - Intronic
996365718 5:122698682-122698704 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
996386795 5:122917225-122917247 GTCTCACTCTGTCATCAGGCTGG - Intronic
996557511 5:124794355-124794377 GTCTCACTCTGTCATCAGGCTGG + Intergenic
996605969 5:125322304-125322326 GTCTTGCTTTGTACCCAGGCTGG - Intergenic
996617877 5:125463081-125463103 GTCTCACTTTGTCACCAGGCTGG - Intergenic
996679518 5:126216040-126216062 GTCTCACTATGTGCTCAGTCTGG - Intergenic
996717203 5:126597578-126597600 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
996857506 5:128025683-128025705 GTTTCAGTTTGTGCTCAGAAAGG + Intergenic
996904579 5:128583624-128583646 GTCTCACTCTGTAGCCAGGCTGG + Intronic
997016994 5:129947591-129947613 GTCTCGCTATGTGCTCAGGCTGG - Intronic
997047513 5:130336324-130336346 GTCTCACTTTGTTGTCAGGCTGG - Intergenic
997298464 5:132784705-132784727 GTCTCACCCTGTACCCAGGCTGG - Intronic
997475458 5:134139877-134139899 GTCTTAATTTGTATTCAGAATGG - Intronic
997493396 5:134298901-134298923 GTCTCGCTCTGTGCTCAGGCTGG + Intronic
997514764 5:134479314-134479336 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
997942664 5:138172491-138172513 GTCTCACTCTGTCCCCAGGCTGG - Intronic
998648095 5:144086420-144086442 GTCTCACTATGTAGCCAGGCTGG + Intergenic
998657623 5:144199744-144199766 GTCTCGCTTTGTCATCAGGCTGG + Intronic
998805905 5:145917807-145917829 GTCTCACTTTGTCACCAGGCTGG + Intergenic
999219537 5:149963306-149963328 GTCTCACTTTGTCTCCAGGCCGG + Intronic
999349159 5:150850748-150850770 GTCTCACTATGTTGCCAGACTGG + Intronic
999883428 5:155892423-155892445 GTCTCACTCTGTTGCCAGACTGG - Intronic
999957529 5:156718771-156718793 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1000080141 5:157837671-157837693 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1000509893 5:162167536-162167558 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1000526500 5:162365272-162365294 GTCTCACTCTGTCATCAGTCTGG + Intergenic
1000850969 5:166339823-166339845 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1000887633 5:166765450-166765472 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1001146230 5:169187141-169187163 GTCTCACTTTGTCAGCAGGCTGG + Intronic
1001197638 5:169687952-169687974 GTCTCCCTTTTCACCCAGACTGG + Intronic
1001426675 5:171627474-171627496 GTCTCACTTTGTTGTCAGGCTGG + Intergenic
1001730430 5:173950573-173950595 GTCTCACTTTTCACCCAGGCTGG - Intronic
1001803459 5:174563450-174563472 GTCTCACTCTGTCGCCAGACTGG - Intergenic
1001920093 5:175593233-175593255 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1002589358 5:180278667-180278689 GTCTCACTTTGTCACCAGGCTGG - Intronic
1002829765 6:809004-809026 GTCTCACTGTGTCTCCAGACTGG - Intergenic
1003578970 6:7322243-7322265 GTCTCACTCTGTAGCCAGGCTGG + Intronic
1003585126 6:7381867-7381889 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1003640380 6:7870655-7870677 GTCTCACTCTGTTGCCAGACTGG + Intronic
1003769216 6:9278814-9278836 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1004333998 6:14747517-14747539 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
1004371641 6:15057696-15057718 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
1004397118 6:15255167-15255189 GTCTCACTTTGTTGCCAGGCTGG + Intronic
1004568989 6:16826700-16826722 GTCTCACTCTGTCGTCAGGCTGG - Intergenic
1004742211 6:18472966-18472988 GTCTCACTTTGTGGCCAGGCTGG - Intergenic
1004770484 6:18775597-18775619 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1004853769 6:19727644-19727666 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1004995233 6:21184678-21184700 GTCTCACTCTGTTCCCAGGCTGG + Intronic
1005023324 6:21438298-21438320 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1005160649 6:22858798-22858820 GTCTCACTTGTTACCCAGGCTGG + Intergenic
1005201331 6:23348013-23348035 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1005261993 6:24070934-24070956 GTCTCACTCTGTTGCCAGACTGG - Intergenic
1005324404 6:24684980-24685002 GTCTCACTTTGTCACCAGGCTGG - Intronic
1005719061 6:28582890-28582912 GTCTCACTCTGTCCCCAGGCAGG - Intronic
1006125893 6:31837915-31837937 GTCTCACTTTGTGCACAGGCTGG + Intronic
1006562123 6:34922721-34922743 GTCTCACTCTGTAGCCAGGCTGG + Intronic
1006627224 6:35405954-35405976 GTCTCAATCTGTCCTCAGGCTGG + Intronic
1007100901 6:39245923-39245945 GTCTAGCTTTGTAGCCAGACTGG + Intergenic
1007307315 6:40917300-40917322 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
1007324717 6:41051215-41051237 GTCTCACTCTGTCACCAGACTGG - Intronic
1007510968 6:42374101-42374123 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1007564743 6:42841216-42841238 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1007798635 6:44372490-44372512 GTCTCACTTTGTCACCAGGCTGG + Intronic
1007810031 6:44479067-44479089 GTCTCACTTTGCCCTCGGATAGG - Intergenic
1008245727 6:49170324-49170346 GTCTCACTGTGTTGCCAGACTGG + Intergenic
1008255577 6:49295832-49295854 GTCTCACTCTGTTGCCAGACTGG + Intergenic
1008457944 6:51733505-51733527 GTCTCCCTCTGTCCTCAGGCTGG - Intronic
1008912638 6:56752216-56752238 GTCTCCCATTGGACTAAGACAGG - Intronic
1009423555 6:63489734-63489756 GTCTCACTCTGCACCCAGGCTGG + Intergenic
1010045222 6:71434546-71434568 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
1010127926 6:72455519-72455541 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1010208195 6:73341866-73341888 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1010662050 6:78583107-78583129 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1011004164 6:82625071-82625093 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1011046442 6:83088450-83088472 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1011053962 6:83185727-83185749 GTCTCACTTTGTCGCCAGGCTGG - Intronic
1011134416 6:84085082-84085104 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1011590740 6:88968340-88968362 GTCTCACTCTGTAACCAGGCTGG + Intergenic
1011602441 6:89072154-89072176 GTCTCACTTTGTTCTCAGGATGG - Intergenic
1011694407 6:89899048-89899070 GTCTCACTCTGTCCTCAGGCTGG + Intergenic
1011772846 6:90694067-90694089 GTCTCACTCAGTACTGAGGCTGG - Intergenic
1012366055 6:98442341-98442363 GTCTCATTCTGTGCTCAGGCTGG + Intergenic
1012698791 6:102425486-102425508 GTCTCACTCTGTCACCAGACTGG + Intergenic
1012867161 6:104632257-104632279 GTCTCACTGTGTCGTCAGGCTGG - Intergenic
1012910141 6:105108988-105109010 GTCTCACTCTGTGCCCAGGCTGG + Intronic
1013256763 6:108395429-108395451 GTCTCACTCTGCACCCAGGCTGG + Intronic
1013361529 6:109397919-109397941 GTCTCACCCTGTCGTCAGACTGG + Intronic
1013492446 6:110661468-110661490 GTCTCACTATGTTGCCAGACAGG + Intronic
1014019943 6:116575279-116575301 GTCTCACTATGTTCCCAGGCTGG + Intronic
1014263936 6:119252760-119252782 GTCTCACTTTGTCACCAGGCTGG - Intronic
1014829522 6:126085649-126085671 GCATCACCTTGAACTCAGACAGG - Intergenic
1015009856 6:128332453-128332475 GTCTCATTTAGTCCTCACACCGG - Intronic
1015089632 6:129339971-129339993 GTCTCGCTCTGTAGTCAGGCTGG - Intronic
1015822532 6:137279785-137279807 ATCTCACTTTGTATTTAGAGGGG + Intergenic
1015891846 6:137977483-137977505 GTCTCACTCTGTTGCCAGACTGG + Intergenic
1015956328 6:138602369-138602391 GTCTCACTCTGTCTTCAGGCTGG + Intronic
1015966649 6:138701022-138701044 GTCTCACTCTGTCGTCAGGCTGG + Intergenic
1016526119 6:145003164-145003186 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
1016898031 6:149073238-149073260 TTCTCACCATGTACCCAGACTGG - Intronic
1016950195 6:149572049-149572071 GTCTCACTTTGTCGCCAGGCTGG - Intronic
1017104269 6:150873283-150873305 GTCTCACTTTGTTTCCAGGCTGG - Intronic
1017131130 6:151109075-151109097 GTCTCACTCTGTCACCAGACTGG + Intergenic
1017172709 6:151472780-151472802 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1017307470 6:152935892-152935914 GTCTCACTTTGTTGCCAGACTGG + Intergenic
1017865909 6:158443011-158443033 GTCTCACTCTGTCACCAGACTGG + Intronic
1017934513 6:158993145-158993167 GTCTCACTCTGTCGCCAGACTGG + Intronic
1017944221 6:159080524-159080546 GTCCCACTTTGTGCACAGACTGG + Intergenic
1019036773 6:169067375-169067397 GTCCCACTTTGTCCTGACACCGG - Intergenic
1019723637 7:2588381-2588403 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1019831098 7:3331232-3331254 GTCTCGCTTTGTTGCCAGACTGG - Intronic
1019903818 7:4045270-4045292 GTCTCACTCTGTGCCCAGGCTGG + Intronic
1020126837 7:5537729-5537751 GTCTCACTTTGTCACCAGGCTGG + Intronic
1020164679 7:5798542-5798564 GTGTCACTTTGTGCCCAGGCTGG - Intergenic
1020236422 7:6359354-6359376 GTCTCACTCTGTTGTCAGCCTGG + Intergenic
1020321526 7:6941952-6941974 GTCTCACTCTGTCACCAGACTGG - Intergenic
1020629623 7:10624846-10624868 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1020829065 7:13070796-13070818 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1020833010 7:13114482-13114504 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1020859603 7:13474385-13474407 GTCTCGCTCTGTCCTCAGGCAGG - Intergenic
1021985983 7:26099038-26099060 GTCTCACTTGTCACTCAGGCTGG + Intergenic
1022001402 7:26229790-26229812 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1022463628 7:30635719-30635741 GTCTCGCTCTGTGCCCAGACTGG - Intergenic
1022559470 7:31334346-31334368 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
1022720270 7:32936262-32936284 GTCTCACTCTGTCGCCAGACTGG - Intergenic
1022894528 7:34736496-34736518 TTCTCTCTTTGTACCCACACTGG + Intronic
1022979541 7:35591401-35591423 GTCTCACTGTGTCCCCAGGCTGG - Intergenic
1023039867 7:36162612-36162634 GTCTCGCTCTGTGCTCAGGCTGG - Intronic
1023214801 7:37849839-37849861 GTCTCACTCTGTTGCCAGACTGG - Intronic
1023373152 7:39531630-39531652 GTCTCACTGTGTTGTCAGGCTGG - Intergenic
1023818108 7:43965587-43965609 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1023950821 7:44843107-44843129 GTCTCACTCTGTCGTCAGGCTGG - Intronic
1024788412 7:52934414-52934436 GTCTCACTGTGTCTCCAGACTGG - Intergenic
1025239590 7:57259949-57259971 GTCTCACTCTGTCACCAGACTGG - Intergenic
1025602318 7:63012403-63012425 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1025791420 7:64690769-64690791 GTCTCACTCTGTTGTCAGGCTGG + Intronic
1025795261 7:64733701-64733723 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1025804532 7:64818020-64818042 GTCTCACTCTGCACCCAGGCTGG + Intronic
1025848574 7:65222653-65222675 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1025970379 7:66318494-66318516 GTCTCACTCTGTTGTCAGGCTGG + Intronic
1026062625 7:67039691-67039713 GTCTCACTCTGTCATCAGGCTGG + Intronic
1026160804 7:67867204-67867226 GTCTCACTATGTTCCCAGGCTGG + Intergenic
1026197848 7:68188407-68188429 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1026201850 7:68221219-68221241 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
1026382723 7:69815542-69815564 GTCTCACTCTGTCGCCAGACTGG + Intronic
1026563786 7:71472654-71472676 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1026662567 7:72314949-72314971 GTCTCACTGTGTGCTGAGGCTGG - Intronic
1026715723 7:72787739-72787761 GTCTCACTCTGTCATCAGGCTGG - Intronic
1026764372 7:73150691-73150713 GTCTCACTCTGTAGCCAGACTGG - Intergenic
1026846457 7:73701490-73701512 GTCTCACTCTGTCATCAGGCTGG - Intronic
1027040842 7:74960462-74960484 GTCTCACTCTGTAGCCAGACTGG - Intergenic
1027049404 7:75012330-75012352 GTCTCGCTCTGTCCCCAGACTGG + Intronic
1027082796 7:75241895-75241917 GTCTCACTCTGTAGCCAGACTGG + Intergenic
1027373097 7:77527966-77527988 GTCTCTCTTTGTCCCCAGGCTGG - Intergenic
1027392891 7:77723496-77723518 GTCTCACTCTTTGCCCAGACTGG + Intronic
1027622377 7:80505394-80505416 GTCTCACTCTGTGCCCAGGCTGG + Intronic
1027683670 7:81253867-81253889 GTCTCACTCTGTCATCAGTCTGG - Intergenic
1027815752 7:82968547-82968569 GTCTCACTTTGTCACCAGGCTGG + Intronic
1027982567 7:85244738-85244760 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
1028340614 7:89715545-89715567 GTCTCTCTTTGTGCCCAGGCTGG + Intergenic
1028543782 7:91975197-91975219 GTCTCACTTTGTGTCCAGGCTGG + Intronic
1028573570 7:92319903-92319925 GTCTCACTTTGTCGCCAGGCTGG - Intronic
1028634572 7:92972734-92972756 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1028791609 7:94859981-94860003 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1028929366 7:96396345-96396367 GTCTCACTCTTTGCTCAGGCTGG - Intergenic
1028930188 7:96404372-96404394 GTCTCACTTTTTGCCCAGGCTGG + Intergenic
1029134259 7:98357535-98357557 GTCTCACTTTGTCGCCAGGCTGG - Intronic
1029200058 7:98833448-98833470 GTCTCACTCTATTGTCAGACTGG + Intergenic
1029742736 7:102500440-102500462 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1029760726 7:102599605-102599627 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1029859319 7:103552530-103552552 ATCTCACTTTGTGCCCAGGCTGG + Intronic
1029982257 7:104890101-104890123 GTCTCACTATGTAGCCAGGCTGG - Intronic
1030067476 7:105671251-105671273 GTCTCACTCTGTTGTCAGGCTGG - Intronic
1030579973 7:111342560-111342582 GTCTCACTCTGTCGCCAGACTGG - Intronic
1030651939 7:112125836-112125858 GTCTCACTTGTCACCCAGACTGG + Intronic
1030771442 7:113480145-113480167 GTCTCACTCTGTTCCCAGGCAGG - Intergenic
1030815855 7:114036584-114036606 GTCCCACTTTTTAACCAGACTGG + Intronic
1031118973 7:117699062-117699084 GTCTCACTCTGTAACCAGGCTGG + Intronic
1031214212 7:118870009-118870031 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1031216696 7:118901567-118901589 GTTTCACTTTGTAGTCAAACTGG - Intergenic
1031610407 7:123819918-123819940 GTCTCACTCTGTCACCAGACTGG + Intergenic
1031750182 7:125562230-125562252 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
1031794494 7:126154439-126154461 GTTTCACTTTATACTCAGGTTGG - Intergenic
1031801277 7:126249261-126249283 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1031941178 7:127791172-127791194 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1032064058 7:128751256-128751278 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1032145718 7:129378280-129378302 GTCTCACTCTGTAGCCAGGCTGG - Intronic
1032162301 7:129520251-129520273 GTCTCACTCTGTGCCCAGGCTGG + Intergenic
1032571825 7:133008844-133008866 CTCTCACTTTGTTCCCTGACTGG + Intronic
1032583182 7:133122466-133122488 GTCTCACTATGTTCCCAGGCTGG - Intergenic
1032847581 7:135764984-135765006 GTCTCACTGTGTCATCAGGCTGG - Intergenic
1032861681 7:135885724-135885746 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
1032871288 7:135988775-135988797 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
1033199625 7:139358035-139358057 GTCTTGCTTTGTACCCAGCCTGG + Intronic
1034515816 7:151578313-151578335 GTCTCACTCTTCACTCAGGCTGG - Intronic
1034575978 7:151998005-151998027 GTCTCACTGTGTTGTCAGGCTGG - Intronic
1034593640 7:152166150-152166172 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1034716785 7:153250610-153250632 GTCTCACTCTGTTGTCAGATTGG - Intergenic
1035196102 7:157221897-157221919 GTCTCACTGTGTGCTCAGGCTGG + Intronic
1035455319 7:159005183-159005205 GTCTCACTCTGTGTGCAGACTGG - Intergenic
1035898541 8:3432537-3432559 GTCTCACTTTGTCACCAGGCTGG + Intronic
1036074355 8:5478105-5478127 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
1037075651 8:14713995-14714017 GTCTCACTCTGTACCCAGGCTGG + Intronic
1037343314 8:17870874-17870896 GTCTCACTCTGTAGCCAGGCTGG - Intronic
1037346493 8:17906649-17906671 GTCTCACTTTGTCACCAGGCTGG - Intronic
1037490996 8:19397079-19397101 GTCTTGCTTTGTAGCCAGACTGG - Intergenic
1037563913 8:20100379-20100401 GTCTCACTGTGTTCCCAGGCTGG + Intergenic
1037778723 8:21852893-21852915 GTCTCACTCTGTCACCAGACTGG - Intergenic
1037929741 8:22871582-22871604 GTCTCACTCTGTTGCCAGACTGG + Intronic
1038451236 8:27640413-27640435 GTCTCACTCTGTGCCCAGGCTGG + Intronic
1038552458 8:28481778-28481800 GTCTCACTGTGTCACCAGACTGG - Intronic
1038757634 8:30356796-30356818 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1038815181 8:30895708-30895730 GTCTCACTGTGTCCCCAGGCTGG + Intergenic
1038912910 8:31987268-31987290 GTCTCACTCTGTCACCAGACTGG - Intronic
1038913762 8:31996534-31996556 GTCTCACTTGTTACTCAGGCTGG - Intronic
1038940496 8:32298995-32299017 GTCTAACTTTGTCCCCAGGCTGG - Intronic
1039054016 8:33519966-33519988 GTCTCACTTGTTGCTCAGGCTGG - Intergenic
1039197611 8:35049607-35049629 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
1039224467 8:35372795-35372817 GTCTCACATTTTACCCAGGCTGG + Intronic
1039464007 8:37770605-37770627 GTCTCACTCTGCACCCAGACTGG + Intronic
1039553810 8:38462472-38462494 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1040024728 8:42771288-42771310 GTCTCACTTTGTCACCAGGCTGG - Intronic
1040422536 8:47253389-47253411 GTCTCACTCTGTCCCCAGTCTGG - Intergenic
1040462797 8:47664864-47664886 GTCTCACTCTGCACCCAGGCTGG - Intronic
1041007387 8:53508320-53508342 GTCTCACTCTGCACACAGGCTGG - Intergenic
1041112895 8:54503402-54503424 GTCTCACTGTGTGCCCAGGCTGG + Intergenic
1041159621 8:55026214-55026236 AACTCACTCTGTACTCAGCCTGG - Intergenic
1041687741 8:60659746-60659768 GTCTCACTCTGTTGTCAGGCTGG - Intergenic
1042335786 8:67629083-67629105 GTCTCACTCTGTCATCAGGCTGG - Intronic
1042352244 8:67789126-67789148 GTTTCACTTTGTTGTCAGGCTGG - Intergenic
1042555052 8:70027240-70027262 GTCTCACTCTGTCATCAGGCTGG + Intergenic
1042948025 8:74174439-74174461 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
1043003487 8:74788918-74788940 GTCTCACTCTGTCGCCAGACTGG + Intronic
1043033781 8:75171424-75171446 GTCTCACTTTGCACCCAGGCTGG + Intergenic
1043089625 8:75881796-75881818 GTCTCACTATGTACCCAGTCTGG + Intergenic
1043434159 8:80222280-80222302 GTCTCACTGTGTCATCAGGCTGG + Intronic
1043666003 8:82814920-82814942 GTCTCACTTTGTAGCCAGGCTGG + Intergenic
1043773875 8:84239860-84239882 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1043967098 8:86491162-86491184 GTCTCACTCTGTCGTCAGGCTGG + Intronic
1044108066 8:88236717-88236739 GTCTCGCTTTTTACCCAGGCTGG - Intronic
1044521956 8:93208913-93208935 GTCTCACTCTGTTGTCAGGCTGG - Intergenic
1044709804 8:95046088-95046110 GTCTCGCTTTGTCCCCAGGCTGG + Intronic
1045001637 8:97883580-97883602 GTCTCACTCTGTCCCCAGACTGG + Intronic
1045029748 8:98123745-98123767 GTCTCACTCTGTCTTCAGGCTGG - Intronic
1045294981 8:100864560-100864582 GTCTCACTCTGTTGTTAGACTGG - Intergenic
1045307011 8:100966509-100966531 GTCTCACTCTGTTGTCAGGCTGG - Intergenic
1045336321 8:101206445-101206467 GTCTCGCTATGTACTCAGGCTGG - Intergenic
1045364726 8:101465029-101465051 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
1045470356 8:102506865-102506887 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1045580272 8:103471027-103471049 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1046054313 8:109060927-109060949 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1046247823 8:111589496-111589518 GTCTCACTCTTTACCCAGGCTGG + Intergenic
1046372024 8:113322773-113322795 GTCTCGCTTTGTGCCCAGACTGG + Intronic
1046747029 8:117887379-117887401 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1047267772 8:123324268-123324290 GGTTCACTTTGTACTTAAACAGG + Intronic
1047941105 8:129827957-129827979 GTCTCACTCTGTACCCAGGCTGG - Intergenic
1048665622 8:136657725-136657747 GTCTCACTTTGTGGCCAGGCTGG - Intergenic
1049109184 8:140632940-140632962 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1049130828 8:140838974-140838996 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1049185550 8:141250424-141250446 GTCTTACTCTGTATTCAGGCTGG + Intronic
1049734636 8:144198445-144198467 GTCTTGCTCTGTACTCAGGCTGG + Intronic
1049790694 8:144471338-144471360 GTCACACTTTGTCATCAGGCTGG + Intronic
1050187130 9:2986369-2986391 GTCTCACTCTGCACCCAGGCTGG + Intergenic
1050353905 9:4765033-4765055 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1050550441 9:6744493-6744515 GTCTCACTTTGTCGCCACACTGG - Intronic
1050617835 9:7421093-7421115 GTCTCACTCTGTCCTCAGGCTGG + Intergenic
1050730645 9:8705248-8705270 GTCTCACTTGTCACCCAGACTGG + Intronic
1050733476 9:8735880-8735902 GTCTCACTTGTCACCCAGACTGG - Intronic
1051181283 9:14414403-14414425 GTCTCACTCTGTCCGCAGGCTGG - Intergenic
1051247396 9:15125792-15125814 GTCTCACTTTGTTGTCCGACTGG - Intergenic
1052029917 9:23616982-23617004 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1052118558 9:24679422-24679444 GTCTCACTTTGTCACCAGGCTGG + Intergenic
1052314629 9:27103879-27103901 GTCTCACTCTGTCCTCAATCTGG + Intergenic
1052331247 9:27270907-27270929 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1052775376 9:32727685-32727707 GTCTCACTATGTTCCCAGGCTGG + Intergenic
1052844597 9:33324044-33324066 GTCTCACTACGTGCTCAGGCTGG - Intronic
1053015229 9:34658064-34658086 GTCTCACTTTGTGCCCAGGCTGG + Intronic
1053205890 9:36186361-36186383 GTCTCACTCTGTACCCAGGCAGG + Intergenic
1053339859 9:37316071-37316093 GTCTCACTCTGTTGCCAGACTGG + Intronic
1053442765 9:38129627-38129649 CTCTCTCTTTGAACACAGACAGG + Intergenic
1053481053 9:38416702-38416724 GTCTCATGTTATCCTCAGACTGG + Intronic
1053551156 9:39080689-39080711 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1053610314 9:39706745-39706767 TTCTGCCTTTGGACTCAGACTGG + Intergenic
1053815267 9:41900786-41900808 GTCTCACTCTGTCCCCAGGCTGG + Intronic
1053868351 9:42464774-42464796 TTCTGCCTTTGGACTCAGACTGG + Intergenic
1054087938 9:60764411-60764433 TTCTGCCTTTGGACTCAGACTGG - Intergenic
1054243210 9:62635650-62635672 TTCTGCCTTTGGACTCAGACTGG - Intergenic
1054261838 9:62874444-62874466 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1054557335 9:66670168-66670190 TTCTGCCTTTGGACTCAGACTGG - Intergenic
1054615329 9:67286654-67286676 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1054882943 9:70163922-70163944 GTCTCACTCTGTGCCCAGGCTGG - Intronic
1055055208 9:72017428-72017450 GTCTCACTCTGTCACCAGACTGG + Intergenic
1055061142 9:72070098-72070120 GTCTCACTCTGTCATCAGGCTGG - Intronic
1055285482 9:74724232-74724254 TTCTCACTATGTATGCAGACTGG - Exonic
1055319142 9:75065195-75065217 GTCTCACTCTGTCACCAGACTGG + Intronic
1055424259 9:76177262-76177284 GTCTCACTCTGTTCCCAGGCTGG - Intronic
1055516288 9:77036918-77036940 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1055662244 9:78516246-78516268 GTCTCACTCTGTTGTCAGGCTGG + Intergenic
1055722590 9:79192484-79192506 GTCTCGCTTTGTCATCAGGCTGG - Intergenic
1056316924 9:85399249-85399271 GTCTCACTCTGTTGCCAGACTGG + Intergenic
1056342589 9:85652480-85652502 GTCTCACTCTGTCTTCAGGCTGG - Intronic
1056372001 9:85965597-85965619 GTCTCACTCTGCACACAAACTGG - Intronic
1056432661 9:86543467-86543489 GTCTCACTCTGTTCCCAGGCTGG - Intergenic
1056627273 9:88264137-88264159 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
1056894504 9:90530742-90530764 GTCTCACTCTGTCACCAGACTGG + Intergenic
1056939373 9:90941909-90941931 TTCTTACTGTGTACTCACACAGG + Intergenic
1056979129 9:91291892-91291914 GTCTCACTCTGTCGCCAGACTGG - Intronic
1057034406 9:91801360-91801382 GTCTCACTCTGTCATCAGGCTGG + Intronic
1057374132 9:94503265-94503287 GTCTCACTATGTGCCCAGGCTGG + Intergenic
1057399851 9:94713598-94713620 GTCTCACTGTGAAGTCACACTGG - Intergenic
1057428879 9:94976694-94976716 GTCTCACTTTGTCCCCAGGCTGG + Intronic
1057439692 9:95073827-95073849 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1057534303 9:95883826-95883848 GTCTCACTCTGTTGCCAGACTGG - Intronic
1057644899 9:96864834-96864856 GTCTCACTTTTTGCCCAGGCTGG - Intronic
1057879581 9:98783054-98783076 ATCTCACTTTGTTGCCAGACTGG - Intronic
1058311759 9:103513144-103513166 GTCTCACTCTGTCCCCAGACTGG - Intergenic
1058469837 9:105266160-105266182 GTCTCACTATGTGCCCAGGCTGG + Intronic
1058690176 9:107513283-107513305 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1058725724 9:107802248-107802270 GTCTCACTCTGTCACCAGACTGG + Intergenic
1058907588 9:109494406-109494428 GTCTCACTCTGTCATCAGGCTGG - Intronic
1058933022 9:109740681-109740703 GTCTCACTGTGTTGTCAGGCTGG + Intronic
1058945840 9:109855100-109855122 GTCTCACTGTGTCCCCAGGCTGG + Intronic
1058956806 9:109956529-109956551 CTCTATCTTTGTACTCTGACTGG - Intronic
1059144968 9:111891446-111891468 GTCTCACTCTGTTCCCAGGCTGG + Intergenic
1059156298 9:111991840-111991862 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
1059178324 9:112188294-112188316 GTCTCACTCTGTTCCCAGGCTGG + Intergenic
1059410872 9:114131481-114131503 GTCTCACTTTATAGCCAGGCTGG - Intergenic
1059777423 9:117489372-117489394 GTCTCACTGTGTTCTCGCACTGG - Intergenic
1060014505 9:120075024-120075046 GTCTCACTCTGTCACCAGACTGG + Intergenic
1060162718 9:121380706-121380728 GTCTCACTCTGTGCCCAGGCTGG - Intergenic
1060283716 9:122230258-122230280 GTCTCAGTTTGCACACACACAGG + Intergenic
1060834212 9:126742787-126742809 GTCTCACTCTGTCACCAGACTGG - Intergenic
1060949649 9:127593603-127593625 ATCTCACTCTGTACCCAGACTGG + Intergenic
1061177104 9:129004251-129004273 GTCTCACTTTGTCACCAGGCTGG - Intronic
1061328368 9:129877666-129877688 GTCTCACTCTGTGCCCAGGCGGG - Intronic
1061472811 9:130840984-130841006 GTGTAACTTTGTCCTCAGATGGG + Intronic
1061514299 9:131079662-131079684 GTCTCACTCTGTTGCCAGACTGG - Intronic
1061563525 9:131422082-131422104 GTCTCACTCTGTTCCCAGGCTGG + Intronic
1061610209 9:131740631-131740653 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1061741243 9:132708040-132708062 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1061742247 9:132715899-132715921 GTCTCACTGTGTCCCCAGGCTGG + Intergenic
1061754638 9:132804074-132804096 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1062512126 9:136912189-136912211 GTCTCACTCTGTCGTCAGGCTGG + Intronic
1062678277 9:137761481-137761503 GTCTCACTCTGTTGCCAGACTGG + Intronic
1185476476 X:418643-418665 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1185565644 X:1093055-1093077 GTCTCACTCTGTTCCCAGGCTGG - Intergenic
1185574154 X:1156827-1156849 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
1185857362 X:3548229-3548251 GTCTCACTTTGTTGCCAGGCTGG - Intergenic
1186775049 X:12856172-12856194 GTCTCGCTCTGTCCCCAGACTGG - Intergenic
1186953072 X:14649182-14649204 GTCTCACTCTGTCATCAGGCTGG - Intronic
1187053328 X:15715653-15715675 GTCTCACTTTGTACTCAGACTGG + Intronic
1187129836 X:16491774-16491796 TTCTCACTTTCTACTCTGTCAGG + Intergenic
1187620945 X:21053675-21053697 GTCTCACTCTGTAGCCAGGCTGG - Intergenic
1187796719 X:23011897-23011919 GTCTCACTCTGTCGTCAGGCTGG - Intergenic
1187900049 X:24019291-24019313 GTCTCACTCTGCACCCAGGCTGG + Intronic
1187968352 X:24634714-24634736 GTCTCACTCTGTCCCCAGCCTGG - Intronic
1188298808 X:28482951-28482973 GTCTCACTCTGTCCTCAGGCTGG - Intergenic
1188320648 X:28732837-28732859 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1188330061 X:28859286-28859308 GTCTCACTTTGTCTCCAGGCTGG + Intronic
1188348673 X:29100180-29100202 GTCTCACTCTGTAGCCAGGCTGG - Intronic
1188353503 X:29161029-29161051 GTCTCGCTTTGCACCCAGGCTGG - Intronic
1188407988 X:29836218-29836240 GTCTCACTTTGTCGCCAGGCTGG + Intronic
1188512626 X:30953103-30953125 GTCTCGCTTTGTAGCCAGGCTGG + Intronic
1188917651 X:35932654-35932676 GTCTCACTCTGTCGTCAGGCTGG + Intronic
1188943993 X:36275114-36275136 GTCTCACTCTGTCCTCAGGCTGG + Intronic
1189220636 X:39368927-39368949 GTCTCACTCTGTCCCCAGGCTGG + Intergenic
1189747572 X:44185564-44185586 GTCTCACTCTGCACCCAGGCTGG + Intronic
1190068551 X:47260517-47260539 GTCTCACTATGTGCCCAGGCTGG - Intergenic
1190139771 X:47832619-47832641 GTCTCACTCTGCACCCAGGCTGG - Intergenic
1190299163 X:49046155-49046177 GTCTCACTTTGTCCCCAGGCTGG - Intergenic
1190382768 X:49855625-49855647 GTCTCACTCTGTAGCCAGGCTGG + Intergenic
1190666532 X:52701279-52701301 GTCTCACTGTGTCGCCAGACTGG + Intronic
1190672886 X:52757129-52757151 GTCTCACTGTGTCGCCAGACTGG - Intronic
1191660367 X:63643386-63643408 GTCTCACTCTGTTGCCAGACTGG + Intronic
1192384653 X:70654679-70654701 GTCTCACTTTATGCCCAGGCTGG - Intronic
1192474896 X:71431884-71431906 GTCTCACTCTGTCACCAGACTGG - Intronic
1192624276 X:72711712-72711734 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1192827431 X:74712514-74712536 GTCTCACTCTGTCGCCAGACTGG - Intergenic
1193176163 X:78396286-78396308 GTCTCACTCTGTCATCAGGCTGG - Intergenic
1193184398 X:78495158-78495180 GTCTCACTGTGTCATCAGGCTGG - Intergenic
1193270285 X:79521044-79521066 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1193371925 X:80708784-80708806 GTCTCACTCTGTCCCCAGGCTGG - Intronic
1193861508 X:86673305-86673327 GTCTCGCTCTGTCCCCAGACTGG - Intronic
1194043578 X:88972987-88973009 GTCTCACTGTGTGCCCAGGCTGG + Intergenic
1194055843 X:89130035-89130057 GTCTCACTCTGTTGCCAGACTGG + Intergenic
1194356020 X:92884983-92885005 GTCTCACTCTGTCGCCAGACTGG + Intergenic
1194380415 X:93182927-93182949 GTCTCACTCTGTCACCAGACTGG - Intergenic
1194415251 X:93603820-93603842 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1194457929 X:94127398-94127420 GTCTCTCTCTGTCCCCAGACTGG - Intergenic
1194483839 X:94462125-94462147 GTCTCACTCTGTCGTCAGGCTGG + Intergenic
1194891789 X:99387820-99387842 GTCTCACTCTGTTGTCAGGCTGG - Intergenic
1194998531 X:100618629-100618651 GTCTCACTCTGTTGCCAGACTGG - Intergenic
1195058478 X:101170704-101170726 GTCTCACTGTATCCTCAGCCTGG + Intergenic
1195393020 X:104382781-104382803 GTCTTCTCTTGTACTCAGACTGG - Intergenic
1195932948 X:110097031-110097053 GTCTCACTTTGTGCCCAGGCTGG + Intronic
1195969573 X:110458568-110458590 GTTTCACTTTGGGCTCAGCCAGG + Intergenic
1196307505 X:114121850-114121872 GTCTCACTTTGTCACCAGGCTGG - Intergenic
1196344862 X:114642593-114642615 GTCTCACTTATTAATCTGACTGG - Intronic
1196690400 X:118552846-118552868 GTCTCGCTTTGTGCTCAGGCTGG - Intronic
1196835664 X:119811614-119811636 GTCTCACTCTGTCACCAGACTGG - Intergenic
1196855731 X:119981743-119981765 GTCTCACTGTGTCCCCAGGCTGG - Intergenic
1197201742 X:123754458-123754480 GTCTCACTTGTTGCTCAGCCTGG + Intergenic
1197689070 X:129477525-129477547 GTCTCACTTTGTCACCAGGCTGG - Intronic
1197710022 X:129659253-129659275 GTCACACTTTGAACTCACATAGG - Intergenic
1197781905 X:130167979-130168001 GTCTCATTATGTGCTCAGGCTGG - Intergenic
1198258653 X:134947068-134947090 GTCTCACTCTGTCCCCAGGCTGG - Intergenic
1198995341 X:142567502-142567524 GTCTTCCTTTGTACTCTAACAGG + Intergenic
1199734190 X:150668685-150668707 GTCTCACTTTGTTGCCAGGCTGG - Intronic
1200184745 X:154175041-154175063 GTCTCACTCTGTCGCCAGACTGG - Intergenic
1200190398 X:154212179-154212201 GTCTCACTCTGTCGCCAGACTGG - Intergenic
1200196149 X:154249981-154250003 GTCTCACTCTGTCGCCAGACTGG - Intergenic
1200201804 X:154287099-154287121 GTCTCACTCTGTCGCCAGACTGG - Intronic
1200502761 Y:3971650-3971672 GTCTCACTTTGTCGCCAGGCTGG + Intergenic
1200664366 Y:6001961-6001983 GTCTCACTCTGTCACCAGACTGG + Intergenic
1201142941 Y:11043458-11043480 GTCTCACCTTGTCACCAGACTGG - Intergenic
1201241618 Y:11962309-11962331 GTCTCACTTTGTTGCCAGGCTGG + Intergenic
1201327183 Y:12774435-12774457 GTCTCGCTCTGTCCTCAGGCTGG - Intronic
1201353371 Y:13071058-13071080 GTCTCACTTTGTCACCAGGCTGG - Intergenic