ID: 1187056230

View in Genome Browser
Species Human (GRCh38)
Location X:15743748-15743770
Sequence CAGGGGATGCAGCAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 777
Summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 688}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187056230_1187056241 24 Left 1187056230 X:15743748-15743770 CCCACCTCCTGCTGCATCCCCTG 0: 1
1: 0
2: 4
3: 84
4: 688
Right 1187056241 X:15743795-15743817 ACAAATATTAATAGCAGACTTGG 0: 1
1: 1
2: 6
3: 64
4: 375
1187056230_1187056236 -10 Left 1187056230 X:15743748-15743770 CCCACCTCCTGCTGCATCCCCTG 0: 1
1: 0
2: 4
3: 84
4: 688
Right 1187056236 X:15743761-15743783 GCATCCCCTGGGCATCTGCTTGG 0: 1
1: 0
2: 4
3: 31
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187056230 Original CRISPR CAGGGGATGCAGCAGGAGGT GGG (reversed) Intronic
900147940 1:1166540-1166562 CAGGGGGTGCAGGCGGGGGTGGG - Intergenic
900204500 1:1426285-1426307 CAGGAGGTGCAGCAGGAGCCCGG - Exonic
900423349 1:2565148-2565170 CCGCGGATGCAGCAGGTGGCTGG - Intronic
900551622 1:3259278-3259300 CAGGGGCTGCAGCTGGGGCTGGG + Intronic
901870706 1:12137737-12137759 GAGGGGCTGCTCCAGGAGGTGGG + Intronic
901883086 1:12205291-12205313 AAGGGGCTGTAGCAGGGGGTGGG + Intronic
902469623 1:16639339-16639361 CAGGAGAGACAGCAGGTGGTAGG - Intergenic
902797134 1:18807224-18807246 CAGGGGAAGAGGCAGGGGGTAGG + Intergenic
903268656 1:22174126-22174148 CAGGGGAGGAAACTGGAGGTAGG - Intergenic
903514471 1:23901443-23901465 CCGGGGAGGCTGCAGCAGGTCGG - Intronic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
904360565 1:29968714-29968736 AAGCAGAGGCAGCAGGAGGTGGG + Intergenic
904376268 1:30084348-30084370 CAGAGGAGGGAGCAGAAGGTGGG + Intergenic
904476594 1:30769077-30769099 TAGGGGAAGCAGCTGGAGTTGGG + Intergenic
904916477 1:33973983-33974005 CAGGGGCTGCAGCAGAAGAAGGG - Intronic
904945782 1:34197786-34197808 CAGGACGTGCAGGAGGAGGTCGG - Exonic
905626653 1:39493905-39493927 CAGGGGATGCCAGGGGAGGTCGG - Intronic
905670237 1:39786551-39786573 CAGGGGATGCCAGGGGAGGTCGG + Intronic
906209283 1:44003153-44003175 CAGGGGCTGCAGCAGGTGGAGGG - Intronic
906321859 1:44822297-44822319 GAGGGGATGCAGCAGCAGCAGGG + Exonic
906841786 1:49147062-49147084 CAGGAGGTGGAGCAGGAGATAGG + Intronic
906955498 1:50370628-50370650 GAGGGGATGCATCAGGAGAGAGG - Intergenic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907445196 1:54503114-54503136 CACAGGATGAAACAGGAGGTCGG + Intergenic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
913275635 1:117135318-117135340 CAGGAGGTGCGGTAGGAGGTGGG + Intergenic
913287607 1:117241162-117241184 CAGAGGAGCCAGCAGGAGCTGGG - Intergenic
913317252 1:117563632-117563654 CAAGAGCTGCAGCAAGAGGTTGG + Intergenic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
914720733 1:150286732-150286754 CAGGAGATGCTGTAGTAGGTGGG - Exonic
914998297 1:152563990-152564012 CAGGGGCTGCAGAACAAGGTTGG - Intronic
915299083 1:154941822-154941844 CTGGGGAGGCAGCAGGAGACGGG + Intergenic
915460448 1:156067515-156067537 CAGGGACTGCTGCAAGAGGTAGG + Intronic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
916058326 1:161082973-161082995 GTGGGGAGGCAGCAGGTGGTTGG - Intronic
916432441 1:164744088-164744110 CAGGAGATACACCAGGAGCTAGG + Intronic
916523515 1:165587684-165587706 CAAGAAATGCAGCAGGTGGTGGG + Intergenic
917207307 1:172590775-172590797 CTTGGGATGCAGATGGAGGTAGG - Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918315185 1:183317242-183317264 CAGGGTATGCTGGAGGATGTGGG - Intronic
919420908 1:197369338-197369360 GAGGGGATGCAGGAGGAGAGGGG - Intronic
919791293 1:201292518-201292540 CAGGGGAGGTGGCACGAGGTGGG + Intronic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
920062086 1:203233934-203233956 GAGGAGATGGAGCAGGAGGCAGG - Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
922090308 1:222389478-222389500 CAGGGCATGCTGCCGGAGCTGGG - Intergenic
922564677 1:226593926-226593948 CAGGCGATGAGGCAGGTGGTAGG + Intronic
922720142 1:227896148-227896170 CAGGGGAGGCAGCTGGATGCTGG - Intergenic
923695631 1:236247699-236247721 CTAGGGATGGGGCAGGAGGTGGG - Intronic
924244033 1:242064145-242064167 GAGGGGGTGCAGTAGGAGTTGGG - Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063603008 10:7498938-7498960 CAGGGGATGCATGTGCAGGTGGG - Intergenic
1063934869 10:11066859-11066881 GAGGAGATGCAGCAGGAGCTGGG - Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065562850 10:26980828-26980850 CTGGGGATGTACCTGGAGGTGGG + Intergenic
1066602842 10:37126028-37126050 CCGGGGCTGCAGGAGGAGGTGGG + Intronic
1067015780 10:42755473-42755495 CAGGGGCTTAAGGAGGAGGTTGG - Intergenic
1067044205 10:42975281-42975303 CAGGGGAGGCTGGAGGGGGTGGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067370609 10:45678608-45678630 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067389172 10:45847548-45847570 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067416898 10:46109410-46109432 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067445085 10:46337001-46337023 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067502300 10:46816293-46816315 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067539951 10:47144030-47144052 CAATGGATGGAGCAAGAGGTGGG - Intergenic
1067592287 10:47523727-47523749 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067639403 10:48031800-48031822 CAGGGGAGGCAGCAGGGTGCGGG - Intergenic
1067819079 10:49510848-49510870 TAGGAAATGCAGCAAGAGGTAGG - Intronic
1067874091 10:49988505-49988527 CAGGGGAGGCAGCAGGGTGCGGG + Intronic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1068687007 10:59881011-59881033 AAGGGAGTGCAGCAGGGGGTCGG - Intronic
1069107322 10:64398832-64398854 CAGGGGTTGCAGTAGGAGAGTGG - Intergenic
1069598352 10:69687132-69687154 TAGGGGATGCTCCAGGAGCTTGG + Intronic
1069714862 10:70514151-70514173 GTGGGCATGCAGCAGGAAGTGGG - Intronic
1070136391 10:73697950-73697972 CAGGGGAGGCAGCAGGGTGTGGG - Exonic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070330255 10:75411196-75411218 AAGGGGATGCTGGAGGAGGTTGG + Intergenic
1070621243 10:78013082-78013104 CAGTAGATGCTGCAGGAGATCGG - Intronic
1071384309 10:85104231-85104253 CAGAGGATGGAGCAGCAGGGAGG - Intergenic
1071598946 10:86946969-86946991 AAGGGGCTGCAGAAGGAGGCTGG + Intronic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1072034631 10:91552671-91552693 CTGGGGATGCAGCTGGAGCCGGG - Intergenic
1073119603 10:101113444-101113466 CAGGGGATGTGGGAGGGGGTTGG + Intronic
1073338391 10:102727621-102727643 CAGGGGAGGAAGGAAGAGGTAGG - Intronic
1073509684 10:104035210-104035232 CAGGGGATGCAGCCGGGCCTTGG - Intronic
1073615662 10:104992139-104992161 TAGGGGAGGGAGCAGGGGGTAGG + Intronic
1074079768 10:110158247-110158269 CTCGTGATGCAGCAGGAGTTGGG + Intergenic
1074126196 10:110530506-110530528 CAGAGGATGCTCCAGGAGGGCGG + Intergenic
1074808138 10:117074723-117074745 CAGGAAATGCAGCAGTAGGCAGG + Intronic
1074877577 10:117626101-117626123 CAGGGGGTGCTGCAGGAGATGGG + Intergenic
1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG + Intronic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075738128 10:124676693-124676715 GAGGGGTTGCTGCAGGAAGTTGG - Intronic
1076024706 10:127101696-127101718 AAGGGGAGCCAGCAGCAGGTGGG + Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076197243 10:128527716-128527738 CAGGGGAGGGAGCGGGAGCTGGG - Intergenic
1076755839 10:132571169-132571191 CTGGGAATGCAGCATGAGGCAGG + Intronic
1076816735 10:132918793-132918815 CAGGGGATGCAGGAGGAGTTGGG - Intronic
1076824838 10:132961667-132961689 CAGGGGAGCCAGCATGTGGTAGG - Intergenic
1076829192 10:132985781-132985803 CAGGTGAGGGTGCAGGAGGTTGG + Intergenic
1076886413 10:133264826-133264848 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886430 10:133264905-133264927 CAGAGGCTGCAGCAGGAGCTGGG - Intronic
1076886455 10:133265024-133265046 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886464 10:133265064-133265086 CAGAGGCTGCAGCAGGAGCTGGG - Intronic
1076886481 10:133265143-133265165 CAGAGGCTGCAGCAGGAGCTGGG - Intronic
1076886490 10:133265183-133265205 CAGAGGCTGCAGCAGGAGCTGGG - Intronic
1076886499 10:133265223-133265245 CAGAGGCTGCAGCAGGAGCTGGG - Intronic
1076886509 10:133265263-133265285 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886519 10:133265303-133265325 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1077052073 11:571494-571516 CAGGGGTGGCTGGAGGAGGTGGG - Intergenic
1077068710 11:657268-657290 CAGGGAATGCAAGAGGAGGCTGG + Intronic
1077249083 11:1552841-1552863 CGGGGGCTGCAGGAGGAGGTAGG - Intergenic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077522742 11:3045954-3045976 CAGGGGCTGAAGGGGGAGGTGGG - Intronic
1077533135 11:3106606-3106628 CAAGGGAGGCAGCAGGCGGTGGG - Intronic
1077592381 11:3502419-3502441 CAGGGGCTGCAGGAGGGGGTAGG - Intergenic
1077614482 11:3665303-3665325 GAGGGTTTGCAGCAGGAGATTGG + Intergenic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1080640520 11:34155785-34155807 CAGGGGCTGCAGAAGGCCGTGGG - Intronic
1081462105 11:43281426-43281448 CAAGGGATAGAGCAGGAGGCAGG - Intergenic
1081657673 11:44868174-44868196 CAGGGGACGCAGTTGGAGGCTGG + Intronic
1081757740 11:45556647-45556669 AAGGGGATGGAGCAGGACTTGGG + Intergenic
1083055825 11:59818742-59818764 CAGTTTATGCAGCAGGTGGTAGG + Intergenic
1084035058 11:66504625-66504647 CAGGGGATGTGGCCGGAGGGCGG + Exonic
1084393961 11:68896819-68896841 CAGGGGGTGGAGCAGGGGCTGGG - Intronic
1084506704 11:69572936-69572958 CAGCCCAGGCAGCAGGAGGTTGG - Intergenic
1084943544 11:72626868-72626890 CAGAGGAGGCTGCAGGAGGTTGG - Intronic
1084966972 11:72750106-72750128 GAGGGGATGCAGTAGGAAATGGG - Intronic
1085202378 11:74709293-74709315 CAGGGGAGGCAGCAGGACACAGG + Intronic
1085294453 11:75423240-75423262 CAGGGGATGGAGAAGAAGGTAGG + Intronic
1085510697 11:77086704-77086726 CAGGGGATGGAGTGGGAGGAGGG - Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087142067 11:94774370-94774392 CACAGGAGGCAGGAGGAGGTGGG + Intronic
1088570749 11:111221476-111221498 CTGGGGATGGAGCAAGTGGTTGG - Intergenic
1088598140 11:111455071-111455093 CAGAGGGAGCAGCAGCAGGTGGG + Exonic
1089915159 11:122147548-122147570 CAGGTGCTGGAGCAGGAGATAGG + Intergenic
1090362634 11:126184230-126184252 CCGTGGATGCAGCAAGAGGTCGG + Intergenic
1090386036 11:126358002-126358024 CAGGGGATGGAGAGGGAGCTTGG + Intronic
1090426124 11:126608148-126608170 CCAGGAATGCAGCTGGAGGTGGG + Intronic
1090442848 11:126738366-126738388 CACGGGCTGCAGCTGGAAGTGGG + Intronic
1090978480 11:131695684-131695706 TAGGGGATGGAGCAGCGGGTCGG + Intronic
1091194478 11:133719631-133719653 CTGGGGTTGCGGCAGGAGCTGGG + Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1091309418 11:134562038-134562060 TCAGGGATGCAGCAGCAGGTTGG + Intergenic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1092060736 12:5548331-5548353 CAGGCAAAGCAGCAGGGGGTTGG + Intronic
1092140791 12:6182108-6182130 CAGGGGATGGAGGAGGAGTTGGG + Intergenic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1092465673 12:8729473-8729495 CAGGAGAAGCAGCTGGACGTCGG - Intronic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1093920155 12:24850401-24850423 CAGGGTCTTCAGCAGGTGGTAGG + Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094170507 12:27486336-27486358 AAGGGGATGCAGGAGAAGGCTGG - Intronic
1095500173 12:42829056-42829078 CTGGGGATCCAGCAGGGGGATGG + Intergenic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1095981856 12:47978632-47978654 CAGGGGGTCCAGCAGGACCTTGG + Exonic
1096228369 12:49883492-49883514 CAGGGGAAGGGGCAGGAGCTTGG + Intronic
1096996675 12:55842587-55842609 AAGGGGAAGCAGCGGGAGATGGG + Intronic
1097226134 12:57477750-57477772 TGGGGGAGGGAGCAGGAGGTGGG - Intronic
1098157006 12:67609505-67609527 CAGGCCATGGAGCTGGAGGTAGG - Intergenic
1100263454 12:92954088-92954110 GAGGGGACACGGCAGGAGGTGGG + Intergenic
1100478175 12:94953096-94953118 CAGGACATGCAGCAGGAGTATGG - Intronic
1100982179 12:100170536-100170558 CAGGGGATGGGGCAGGCGGTTGG + Intergenic
1101395338 12:104342165-104342187 CTGGGGAGGGAGCAGGAGATTGG - Intronic
1101841311 12:108329269-108329291 CAGGGATGGCAGGAGGAGGTCGG - Intronic
1101920126 12:108925650-108925672 CAGGGGAAGAAGTAGAAGGTGGG - Intronic
1102315462 12:111883956-111883978 CTAGGGATGCAACAGGAGGGAGG - Intronic
1102576642 12:113860096-113860118 CAGAGGAGGCACCAGGAGGGGGG - Intronic
1102970503 12:117162326-117162348 CACGGGATGCCGCATGGGGTGGG + Intronic
1103016775 12:117500804-117500826 CAGGACATGCAGCAGGAGCTGGG + Intronic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1103904064 12:124318549-124318571 GAGGAGAAGCTGCAGGAGGTCGG - Intergenic
1104070719 12:125343058-125343080 AAAGGGATACAGCTGGAGGTAGG + Intronic
1104180617 12:126376774-126376796 CAGGCCATGCAGCAGGAAGTTGG + Intergenic
1104328734 12:127824608-127824630 CAGGGGATGAAGCAGGTAGGAGG - Intergenic
1104410174 12:128551213-128551235 CAGGGGAGGAAGCGGGAGGGGGG - Intronic
1104418751 12:128617532-128617554 AAGGAGATGTAGCAGCAGGTGGG + Intronic
1104726412 12:131078204-131078226 CTGGGGGTGCAGCAGCAGGTCGG + Intronic
1104998814 12:132675461-132675483 CTGAGCATGCAGCAGGAGATAGG - Exonic
1105874247 13:24539564-24539586 CTGGGGCTGCTGCAGGAGGAGGG - Intergenic
1106615464 13:31323103-31323125 CAGGGGACGGAGGAGGGGGTTGG + Intronic
1107805746 13:44152402-44152424 GAGGGGATGCAGCTGGAGAGAGG - Intronic
1109950122 13:69490330-69490352 CAGGTGTTGCAGGAGGAGATGGG - Intergenic
1110028710 13:70576676-70576698 TAGGGGGAGCAGGAGGAGGTGGG - Intergenic
1112655638 13:101449951-101449973 CTGGGGACACAGCAGTAGGTTGG - Intergenic
1113582741 13:111440448-111440470 CAGGGGAAGCTGCAGGGGGCAGG - Intergenic
1113646313 13:111998946-111998968 CGGGGGATGCAGGAGGAGAGAGG + Intergenic
1113698754 13:112366966-112366988 CAAGGGAGGCAGCAGGAAGTGGG + Intergenic
1113802890 13:113095686-113095708 CAGGGCCTGGAGCAGGAGGACGG - Intronic
1113885687 13:113657306-113657328 CAGGGGTCGCAGGGGGAGGTGGG + Intronic
1113944431 13:114035900-114035922 CAGAGGCTGTAGCAGGAGGCTGG + Intronic
1114550720 14:23531424-23531446 CAGGGAGGGCAGCAGGATGTGGG - Intronic
1114675074 14:24434845-24434867 CATGGCCTGCAGGAGGAGGTGGG + Intronic
1116611224 14:47074654-47074676 CAGCAAATGCAGCAGGAGTTTGG - Intronic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117870873 14:60198760-60198782 CAGTGGATGCTGCAGGTGTTGGG + Intergenic
1118312904 14:64706002-64706024 CTGGGGATGGGGCAGGAAGTTGG + Intronic
1118717889 14:68573278-68573300 GAGGGGGCACAGCAGGAGGTGGG - Intronic
1119322339 14:73739434-73739456 CAGAAGGTGCAGCTGGAGGTAGG - Exonic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1120860192 14:89248071-89248093 GAGGGGTTGGAGCAGGAGGAAGG - Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121417864 14:93791335-93791357 CAGGGGCGTCAGCAGGATGTGGG - Intergenic
1122053575 14:99076942-99076964 AAGGGGATGCAGCAGGTAGTGGG + Intergenic
1122112260 14:99510674-99510696 CAGGGGGGACGGCAGGAGGTGGG - Exonic
1122262412 14:100530933-100530955 TGGGGGACGCAGGAGGAGGTGGG + Intergenic
1122283274 14:100636741-100636763 CAGGGGAAGGAGCAGGGAGTGGG - Intergenic
1122409016 14:101516759-101516781 ATGGGGATGCTGGAGGAGGTGGG - Intergenic
1122886228 14:104711648-104711670 CCGGGGCAGCTGCAGGAGGTCGG - Exonic
1123472709 15:20566848-20566870 CAGGGGACGCGGCAGGTGGTTGG - Intergenic
1123485828 15:20737520-20737542 CAGGGGATGAGGCAGGAGCATGG + Intergenic
1123542316 15:21306563-21306585 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123614994 15:22137541-22137563 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123645297 15:22433505-22433527 CAGGGGACGGGGCAGGTGGTTGG + Intergenic
1123666565 15:22613146-22613168 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1123733014 15:23161839-23161861 CAGGGGACGGGGCAGGTGGTTGG - Intergenic
1123751143 15:23359216-23359238 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1124001914 15:25767220-25767242 CAGGTGCTGCAGCAGAACGTAGG + Intronic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1124256526 15:28147023-28147045 CTGGGGGGGCCGCAGGAGGTGGG + Intronic
1124283518 15:28383134-28383156 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1124299180 15:28528479-28528501 CAGGGGACGGGGCAGGTGGTTGG + Intronic
1124320408 15:28707719-28707741 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124439281 15:29675039-29675061 CCAGAGCTGCAGCAGGAGGTCGG - Intergenic
1124482106 15:30087691-30087713 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124488564 15:30139791-30139813 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124521482 15:30409512-30409534 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124537179 15:30556707-30556729 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124543650 15:30608763-30608785 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124567704 15:30832070-30832092 CTGGGGGGGCCGCAGGAGGTGGG - Intergenic
1124754964 15:32398531-32398553 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124761474 15:32450884-32450906 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124777158 15:32598184-32598206 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1126114827 15:45199058-45199080 TGGAGGATGCAGCAGGAGGGAGG - Exonic
1126778152 15:52117489-52117511 AAAAGGATGCAGCAGGGGGTGGG - Exonic
1126890457 15:53199049-53199071 CAGAGGATGCTTCAGGAGCTCGG - Intergenic
1127773754 15:62250298-62250320 CAGGGTATGGGGCAGGCGGTTGG + Intergenic
1127775294 15:62259893-62259915 CAAGGGATGGGGCAGGCGGTAGG + Intergenic
1128151563 15:65366529-65366551 CAGAGGGGGCAGCAGGGGGTGGG + Intronic
1128264195 15:66253364-66253386 CAGGGGGTCCGGCAGGATGTAGG - Intronic
1128585431 15:68845367-68845389 CACGGGATGCAGGTGGAGGGAGG - Intronic
1128704151 15:69826308-69826330 CAAGGGAACCAGCAGGTGGTTGG - Intergenic
1128786361 15:70400251-70400273 CAGTGGCTGGAGCAAGAGGTGGG + Intergenic
1128840413 15:70846141-70846163 CATGGGAGGTGGCAGGAGGTGGG - Intronic
1128880396 15:71237093-71237115 CAAGAGATGCAGCAGGAGCCAGG + Intronic
1128997011 15:72304706-72304728 CACGGGTTGCAGCCTGAGGTTGG + Intronic
1129029671 15:72609204-72609226 CAGGGGATGGGGCAGCTGGTTGG - Intergenic
1129037607 15:72660236-72660258 CAGGGGATGGGGCAGCTGGTTGG - Intronic
1129212280 15:74076989-74077011 CAGGGGATGGGGCAGCTGGTTGG + Intronic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129388404 15:75208208-75208230 CAGGGGATGGAGCTGGAGCAGGG - Exonic
1129398117 15:75264090-75264112 CAGGGGATGGGGCAGCTGGTTGG - Intronic
1129401728 15:75288371-75288393 CAGGGGATGGGGCAGCTGGTTGG - Intronic
1129729409 15:77921307-77921329 CAGGGGATGGGGCAGCTGGTTGG + Intergenic
1129839107 15:78732663-78732685 CAGGGGATGGGGCAGCTGGTCGG - Intergenic
1130350269 15:83085184-83085206 GTGGGGAGGCAGCAGGAGGTGGG + Intergenic
1130827389 15:87563348-87563370 CAGGGGATGGGGCGGCAGGTGGG + Intergenic
1130957408 15:88637467-88637489 CAGGGCATGAAGATGGAGGTGGG + Intronic
1131278658 15:91003396-91003418 GGGAGGATGCAGCAGGAGGGAGG + Intronic
1202950633 15_KI270727v1_random:33704-33726 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1202987239 15_KI270727v1_random:429304-429326 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1132539963 16:504128-504150 GAGGGGGTACAGGAGGAGGTGGG - Intronic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1132651151 16:1021956-1021978 CAGGGGGTGCAGGAGCAGCTGGG - Intergenic
1132726124 16:1339075-1339097 CAGGTGGTGCCCCAGGAGGTGGG - Intronic
1132727753 16:1346096-1346118 GAGGGGAGCCGGCAGGAGGTGGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133490670 16:6264986-6265008 CATGGGAGGCAGGACGAGGTTGG - Intronic
1133734858 16:8607334-8607356 CAGGGGAGGCAGCGTGATGTGGG - Intergenic
1133736036 16:8616508-8616530 CAGGGGCTGGACCTGGAGGTGGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134647466 16:15881638-15881660 TGGGGGATGCAGCTGGGGGTTGG - Intronic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1136173059 16:28499753-28499775 CAAGGAGTGCAGCAGGCGGTAGG + Exonic
1136371284 16:29837909-29837931 GAGGGGATGAAGTAGGGGGTGGG - Intronic
1136616591 16:31402050-31402072 CAGGAGCTGCAGGAGGGGGTTGG + Intronic
1137780560 16:51094718-51094740 CAGGTGATGCAGCAGAACGCAGG - Intergenic
1138009186 16:53361988-53362010 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1138296164 16:55886954-55886976 CAGTGGATGCAGCATATGGTAGG - Intronic
1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG + Intronic
1138597140 16:58035078-58035100 AAGGGAATGCAGCTGGAGGCCGG - Intronic
1139492339 16:67293003-67293025 GAGGAAATGCAGCAGGAGCTAGG - Intronic
1139747206 16:69084132-69084154 TAGGAGATGCAGTTGGAGGTGGG + Exonic
1139890752 16:70251931-70251953 CAGTGGATGCGGCAGGGCGTTGG - Intergenic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1140220695 16:73041667-73041689 CAGTGTGTGCGGCAGGAGGTTGG - Intronic
1140457208 16:75112438-75112460 CAGCTGCTGCAGGAGGAGGTGGG - Exonic
1141187056 16:81795625-81795647 CAGAGGATGGCTCAGGAGGTTGG + Intronic
1141509101 16:84501241-84501263 CAGGTGATTCACCAGGAAGTGGG + Intronic
1141623631 16:85250051-85250073 CAGGAGCTGCAGCAGGAGCCAGG - Intergenic
1141672893 16:85502124-85502146 GAGGGAAGGCAGCTGGAGGTTGG + Intergenic
1141810449 16:86372194-86372216 CAGCTGGTGCAGAAGGAGGTGGG - Intergenic
1141859478 16:86706667-86706689 CCGTGGCTGCAGCAGGAGCTTGG + Intergenic
1142231328 16:88901540-88901562 CCTGGGATGCGGCAGGCGGTGGG + Exonic
1142286906 16:89175202-89175224 CGGTGGAGGCAGCTGGAGGTTGG + Intronic
1142362237 16:89632941-89632963 GAGGGGCTGCAGGAGGAGGAGGG + Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG + Intronic
1143169062 17:4915906-4915928 CAGTGGATGCTGCAGGATATAGG + Intergenic
1143399844 17:6637098-6637120 CAGAGGATGAGACAGGAGGTGGG - Intronic
1143411550 17:6712545-6712567 CTGGGGCTGTAGCAGGAGGCGGG - Intronic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143508967 17:7384737-7384759 GAGGGGCTGCTGCAAGAGGTGGG + Exonic
1143728839 17:8868403-8868425 GAGGGGATAAAGCATGAGGTTGG - Intergenic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144201232 17:12944179-12944201 TGTGGGATGCAGGAGGAGGTAGG + Exonic
1144421269 17:15101363-15101385 GAGGGGATTCAGCAGGAGACCGG - Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1144561737 17:16326053-16326075 CAGGGGAAGAAGCTGGAGTTTGG - Exonic
1144631388 17:16874261-16874283 CAGGGGACGCTGCAAGGGGTGGG - Intergenic
1144649214 17:16997013-16997035 CAGGGGACGCTGCAAGGGGTGGG + Intergenic
1144754028 17:17668707-17668729 CAGGGGGTGCGGGAGGGGGTGGG - Intergenic
1145964259 17:28905843-28905865 AGGGGGAGGGAGCAGGAGGTGGG + Exonic
1145994362 17:29097007-29097029 CCAGGGATGCAGGAGGAAGTCGG + Intronic
1146634163 17:34491808-34491830 CAGGGGCTGGTGCAGGAGATGGG - Intergenic
1147161850 17:38573034-38573056 CTCGGGTTGCAGCAGGAGGGAGG + Intronic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147632343 17:41940210-41940232 CAGGGGAAGCAGCAGGACTCAGG - Intronic
1147647115 17:42040509-42040531 CAGGGCATCCAGCAGCAGGTGGG + Intronic
1148108670 17:45132540-45132562 CGGAGGAGGCAGCAGGAGGTGGG + Intronic
1148485613 17:47988888-47988910 GAGGTGAGGAAGCAGGAGGTGGG + Intergenic
1148592346 17:48825850-48825872 CACAGGATGAGGCAGGAGGTTGG - Intergenic
1148779982 17:50115907-50115929 GTGGGGAGGCAGCAGGAAGTGGG + Intronic
1148804409 17:50257130-50257152 CAGGGGTTGCAGGTGGGGGTGGG + Intergenic
1148913222 17:50954449-50954471 CAGAGGAAGCAGCAGGAACTGGG + Intergenic
1149450226 17:56744312-56744334 CAGGGGCTACAGCAGAAAGTTGG + Intergenic
1149991674 17:61387084-61387106 CAGGGGCCCCAGCAGTAGGTCGG - Intronic
1150043138 17:61884903-61884925 CAAGGGCTGCAGCAGGAGTTGGG - Exonic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151755945 17:76075294-76075316 CGGGGGATGGAGCGGGAGGCGGG + Intronic
1152008254 17:77695680-77695702 CAGGTGAAGCAGCAGCAGATTGG - Intergenic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152390877 17:80003011-80003033 CTGGGGATTCAGCAGGAGAGAGG + Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152655106 17:81515630-81515652 CAGGGCAAGGAGCTGGAGGTGGG - Intronic
1152694043 17:81734919-81734941 CAGGGGAAGCAGCTGCAGGCAGG + Intergenic
1152946246 17:83199074-83199096 TTGGGGCTGCAGCAGGGGGTCGG - Intergenic
1153321088 18:3774918-3774940 CAGGGAGTGCAGGAGGTGGTGGG - Intronic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1154215858 18:12415694-12415716 CAGGGGAAGGAGCAGTGGGTGGG - Intronic
1155163160 18:23211707-23211729 AAGGAGATGCACCAGCAGGTGGG - Intronic
1155248383 18:23932974-23932996 CAGGGATTGGAGCAGGAGGTGGG + Intronic
1155898837 18:31362716-31362738 GAAGGAAAGCAGCAGGAGGTAGG + Intergenic
1156727573 18:40148009-40148031 CAGGCCACGCAGCCGGAGGTGGG - Intergenic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157193509 18:45600710-45600732 CAAGGGAGGCAGCAGGAGGTAGG + Intronic
1157301934 18:46485399-46485421 CTGGGAATGCAGCAGGAGGTGGG + Intronic
1157544164 18:48536280-48536302 CAGAGGAGGCAGCATTAGGTGGG + Intergenic
1157556069 18:48613618-48613640 GATTGGCTGCAGCAGGAGGTGGG + Intronic
1157609824 18:48949463-48949485 AAGGGGGTGCAGAGGGAGGTGGG - Intronic
1157881081 18:51321637-51321659 CTGTGGAGGCAGCAGAAGGTGGG + Intergenic
1158017666 18:52803937-52803959 CTGGGGATGCAGCACCAGATGGG + Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1160019958 18:75172710-75172732 CAGGGCATGCAACAGCAGCTGGG - Intergenic
1160775219 19:852410-852432 CAGAGGGAGCAGCGGGAGGTTGG - Intronic
1160829834 19:1098589-1098611 GAGGGGAGGCAGCAGCAGGAGGG + Intergenic
1160919122 19:1511747-1511769 CAGGGGCTGGATCAGGAGTTGGG + Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161425255 19:4199552-4199574 CAGGGGATGATGCTGGTGGTGGG + Intronic
1161427573 19:4212399-4212421 GAGGCTATGAAGCAGGAGGTGGG + Intronic
1161957856 19:7506349-7506371 CAGGGGATGAAGCCGGGGGAGGG - Intronic
1161964403 19:7540324-7540346 CAGGGGCTGCTGCAGGAGGATGG + Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163472595 19:17506033-17506055 CAGGGGGTGCTGCTGGAGGGAGG - Exonic
1163501031 19:17676363-17676385 CAGGGGATGCAGGGAGAGGGAGG - Intronic
1165076315 19:33281668-33281690 CTGGGGAGGCAGCAGGAGCCCGG + Intergenic
1165121838 19:33564932-33564954 CAGGGGAGGCAGCATGGTGTGGG + Intergenic
1165129270 19:33622022-33622044 CGGCGGCGGCAGCAGGAGGTGGG + Intronic
1165230193 19:34381932-34381954 CAGGAGCTGCAGGAGGAGCTGGG + Intronic
1165232008 19:34393176-34393198 CAGGGTTTCCGGCAGGAGGTGGG + Intronic
1165347796 19:35259712-35259734 TTGGGGATGTAGCAAGAGGTGGG - Intronic
1165355186 19:35299916-35299938 CTGGGGATGCGGCCGGAGGCGGG + Intronic
1165423261 19:35732637-35732659 AAGTGGATGTAGCGGGAGGTGGG - Exonic
1165781642 19:38438077-38438099 CAGGAGATGGAGCAGGATGGTGG - Intronic
1166369628 19:42293684-42293706 CAGGGGCTACAGCTGGAGCTGGG - Exonic
1166424299 19:42662167-42662189 CAGTGGACACAGCAGGAGTTTGG + Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166563309 19:43747732-43747754 CAGGGGCTGCAGGGGGTGGTGGG + Exonic
1166766488 19:45254350-45254372 CAGGGCAGCCAGCTGGAGGTGGG - Intronic
1166859604 19:45802155-45802177 GAGGAGGTGGAGCAGGAGGTTGG - Exonic
1167291937 19:48629355-48629377 CAGCGGAGGCAGCAGGTGGTCGG - Exonic
1167406798 19:49315332-49315354 CAGAGAATGCAACAGCAGGTGGG + Intronic
1168153552 19:54461366-54461388 CAGGTGAGGCAGCGGGCGGTGGG - Exonic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
1168514980 19:57003629-57003651 CAGGGGCTGCAAGAGGAGGAGGG - Intergenic
925314361 2:2909723-2909745 CAGGGGGTGCTGGAGGAAGTGGG + Intergenic
925933851 2:8734149-8734171 AAGGGGAGGCAGCAGGAGTGGGG + Intronic
926704291 2:15825909-15825931 CATGGGAGGGGGCAGGAGGTGGG + Intergenic
927053695 2:19351808-19351830 CAGGGGCGGGAGGAGGAGGTGGG + Exonic
927517400 2:23680349-23680371 CTGGGCATGCAGGAGGAAGTGGG + Intronic
927518940 2:23687821-23687843 CAGGGGACGCGGCTGGAGGGAGG + Intronic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
928320434 2:30278957-30278979 CAGAGGACACAGCAAGAGGTTGG - Intronic
929947945 2:46384357-46384379 CCGGGCATGCAGCAGGCCGTGGG + Intronic
930668523 2:54123627-54123649 CAGGGGATGGAGGAAGAAGTGGG - Intronic
931049150 2:58390547-58390569 CTGGGGATTCAGGAGAAGGTGGG - Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931776972 2:65549184-65549206 CAGCCCTTGCAGCAGGAGGTGGG + Intergenic
932581272 2:72994100-72994122 CAGGGGGTGCAGCAGGAAAAAGG + Intronic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933972345 2:87480401-87480423 CGAGGGATGCAGACGGAGGTTGG - Intergenic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934516999 2:94994516-94994538 CAGGAGATGCAGCTGGACATAGG - Intergenic
934753763 2:96810973-96810995 CACTGGGTGCAGCAGGAGCTGGG + Exonic
934942575 2:98513167-98513189 GAGGCGATGCAGGAGGAGTTGGG - Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
936017522 2:108971027-108971049 CAGGGGATGATGCTGGTGGTGGG + Intronic
936321385 2:111469787-111469809 CGAGGGATGCAGACGGAGGTTGG + Intergenic
936616697 2:114055355-114055377 CAAGGGATGCAGATGGAGGGAGG - Intergenic
936855568 2:116953456-116953478 CTGGGGATGCAGTAGGATTTGGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937403430 2:121605843-121605865 CAGGTGTTGCAGAAGGATGTGGG - Exonic
938178962 2:129162639-129162661 CCCAGGATGCAGGAGGAGGTGGG + Intergenic
938201072 2:129373467-129373489 CAGGGGATGCAGCCTGTGGGAGG + Intergenic
938293820 2:130164331-130164353 CAGGGTCAGAAGCAGGAGGTGGG + Intronic
938297168 2:130185570-130185592 CAAGGGTTACAGCAGGAGGGGGG + Intronic
938462724 2:131508631-131508653 CAGGGTCAGAAGCAGGAGGTGGG - Intergenic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939340977 2:140895746-140895768 AAGGGGATGGAGCAGGAAGGTGG + Intronic
940847038 2:158652721-158652743 CAGGAGCTGGGGCAGGAGGTGGG + Intronic
940996559 2:160156412-160156434 CAGAGGATGCAGGAGGTGCTTGG - Intronic
944128156 2:196317579-196317601 CAGGGGAAGCTGCAGGAGCGGGG - Intronic
944499163 2:200340572-200340594 GAGGGGGTGCAGCAGGAGGTGGG + Intronic
945111242 2:206361862-206361884 CAGAGGATGCAGAAGGTAGTGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946020094 2:216634660-216634682 CAGGGAATGCAGCCGGCGATCGG - Intronic
946162046 2:217841303-217841325 CAGGGGAGCCAGCAGGGAGTGGG + Intronic
946379772 2:219338825-219338847 CAGGGTATGATGCAGGATGTGGG - Intergenic
946458402 2:219848412-219848434 GAGGGGATGGAGCAGGATGGTGG + Intergenic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
1168860784 20:1044637-1044659 CAGGGGATGCAGCATGGTGCAGG - Intergenic
1169403171 20:5301067-5301089 CCTGGGAGGCAGTAGGAGGTGGG + Intergenic
1170664855 20:18378044-18378066 GAGGGGATGAAGAAGGAGATGGG + Intergenic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1172205425 20:33159863-33159885 CAGGAGCTGCAGGAGGTGGTGGG + Intergenic
1172396199 20:34607498-34607520 AAGGGGATGGAGCAGGAAGGTGG - Intronic
1172917225 20:38452143-38452165 GAGGGGTTGCAGCAGGTGGGGGG - Intergenic
1172948040 20:38703634-38703656 CAGGGCATGCAGCAGGGTGGTGG - Intergenic
1173113064 20:40213490-40213512 CAGGGGCTGAAGCAGGAGAATGG + Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1174121424 20:48268607-48268629 CTGGGGATGCTGCAAGGGGTAGG + Intergenic
1174476622 20:50800365-50800387 GAGGGGGAGCAGCAGGAGATGGG + Intronic
1175037623 20:56015172-56015194 CTGGTGCTGCAGCAGGAGCTGGG + Intergenic
1175227783 20:57454905-57454927 CTGGGGATTCTGCAGGAGGCTGG + Intergenic
1175266547 20:57706877-57706899 CAGGGGAACCAGCAGTGGGTGGG + Intronic
1175547172 20:59785891-59785913 CAGGGGATGCAGAGGGCCGTTGG - Intronic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175874596 20:62223404-62223426 CAGAGGCAGCAGCAGCAGGTGGG - Intergenic
1178272001 21:31199400-31199422 GAGGGGATGCAGGAGATGGTGGG - Intronic
1178635163 21:34296141-34296163 CTGGGCATACAGCAGGTGGTAGG + Intergenic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179485379 21:41706714-41706736 CAGGGGAGGGAGCTGGAGGTGGG - Intergenic
1180743132 22:18067593-18067615 CAAGGGCAGGAGCAGGAGGTGGG - Intergenic
1181053289 22:20247611-20247633 CAGGTGCTGCGGCAGGAGATTGG + Intronic
1181318816 22:21989096-21989118 AAGTGGGTGCAGCAGGAGGAAGG + Intergenic
1181403401 22:22665456-22665478 CAGGTGATGCTTCAGGAGATGGG + Intergenic
1181405713 22:22683878-22683900 CAGGTGATGCTTCAGGAGATGGG + Intergenic
1181468048 22:23120795-23120817 CAGGTGATGGAGCTTGAGGTGGG - Intronic
1181807316 22:25383052-25383074 GAGGGGCTGCAGCAGAATGTAGG - Intronic
1182626182 22:31648221-31648243 CAGGGGACGCAGCAGGAACATGG + Intronic
1182689201 22:32144747-32144769 CGGGGGCTGAAGCAGGAGGGAGG + Intergenic
1182693545 22:32180428-32180450 CAGGGGATGCAGCAGGGTTCAGG - Intergenic
1183247942 22:36708332-36708354 CAGGGGATGATGCAGGAAGGTGG + Intergenic
1183524175 22:38314050-38314072 CAGGGGCTCCAGCTGGAGCTAGG + Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184928057 22:47658187-47658209 GAGGAGATGCAGCTGGTGGTGGG + Intergenic
1185009433 22:48304996-48305018 ACGGAGATGCAGCAGGGGGTGGG + Intergenic
1185039268 22:48496120-48496142 CAGGGGATGCCTCAGGAAGCAGG - Intronic
1185267583 22:49912353-49912375 CAGGGTTGGCAGCAAGAGGTTGG - Intronic
1185388733 22:50548001-50548023 CAGGGGATGCGGCTGGGGTTGGG - Intergenic
1185388754 22:50548049-50548071 CAGGGGATGCGGCTGGGGTTGGG - Exonic
949920874 3:8999543-8999565 CTGGGGATGAAGTAGGGGGTGGG - Intronic
951898422 3:27633058-27633080 CAGGGCCTGCAGCGGGAGCTGGG + Intergenic
953137696 3:40197314-40197336 CAGCCTGTGCAGCAGGAGGTGGG - Intronic
953926328 3:46984490-46984512 CATGGGATGAAGCAGGAAGATGG - Intronic
954299821 3:49694878-49694900 CAGGAGAGACAGCAGGTGGTAGG + Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954440755 3:50520843-50520865 CAGGGCCTGGAGCAGGATGTAGG - Intergenic
954539501 3:51384464-51384486 CCGGGGAGGCAGGAGGAGGCTGG + Intergenic
954665276 3:52248220-52248242 CAGCGGATCCAGCAGCTGGTAGG + Exonic
954719663 3:52550565-52550587 CAGGGGGTCCAGCTGGATGTGGG + Exonic
954852754 3:53617310-53617332 GAGGGGAGGCAGGAGGAGGTAGG + Intronic
954990111 3:54833375-54833397 AAGGGGTAGGAGCAGGAGGTGGG - Intronic
955097731 3:55816271-55816293 CAGCAGATGCAGCAGCAAGTAGG - Intronic
955813630 3:62819011-62819033 CAGGGGATGGTGGTGGAGGTGGG + Intronic
956420494 3:69081738-69081760 CATGTGATGCAGAAGGAGGCTGG - Intergenic
959849756 3:111072097-111072119 CGGGGGCTGCAGCAGGAGCCCGG - Exonic
960464200 3:117975885-117975907 CAGGGGCTGCAGTTGCAGGTAGG - Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961434239 3:126905630-126905652 CAGGGGATGGAGCAGCGGGGTGG + Intronic
962278034 3:134030268-134030290 GAGGGGATGGAGAAAGAGGTTGG + Intronic
962308763 3:134311481-134311503 CAGAGGCTGAAGCAGGAGGATGG + Intergenic
962352366 3:134665265-134665287 CAGGGGCAGCACCAGGAGGTAGG - Intronic
962412351 3:135152381-135152403 CTGGGGGTACAGCAGGAGCTTGG + Intronic
962726601 3:138234338-138234360 CCGGGGGTGAATCAGGAGGTTGG - Intronic
962938777 3:140106460-140106482 CACAGGATGGAGCAGGAGGTGGG + Intronic
962943648 3:140148123-140148145 AAGGGGCTGTAGCAGGTGGTGGG - Intronic
964640607 3:158906377-158906399 GAGGGAATGCTGAAGGAGGTGGG - Intergenic
966252782 3:177885455-177885477 CAGTGGATACATTAGGAGGTAGG - Intergenic
966508680 3:180736157-180736179 CAGGTGGTACAGCAAGAGGTAGG - Intronic
966828198 3:183983177-183983199 CAGGGCATTCTGCAGGAGCTAGG + Intronic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
968003547 3:195224264-195224286 AGGGGCATGCATCAGGAGGTGGG - Intronic
968005906 3:195242633-195242655 CATGGGAGGCTGGAGGAGGTGGG + Intronic
968502029 4:955300-955322 CAGGGGCTGCGGCAGAAGGGAGG - Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968622504 4:1610277-1610299 CAGGGGAGGCAGCTGGAGTCTGG - Intergenic
968689859 4:1984825-1984847 CTGGGGATGTAGGAGGAGGCGGG + Exonic
968737705 4:2305933-2305955 CTGGCTATGCAGCAGGAGCTGGG + Intronic
969074948 4:4570524-4570546 CAGGGGCTGAGACAGGAGGTGGG + Intergenic
969279458 4:6160507-6160529 CAGGGCATGCAGCATGCGGGAGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969511576 4:7620944-7620966 CAGGGGTCGCAGCAGGAGAAGGG - Intronic
969657827 4:8508327-8508349 CAGGGGCTGCGGCTGGAGGTTGG + Intergenic
969835496 4:9836769-9836791 GAGAGGATGCAGCAGGCTGTTGG + Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
971321866 4:25612181-25612203 CAGTGGAAGCAGCAGAAGGGTGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974639788 4:64613291-64613313 CAAGGATTGCAGCATGAGGTAGG + Intergenic
975021890 4:69501125-69501147 CCGGGGATGGAGCTGGGGGTTGG + Intronic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975157778 4:71090851-71090873 CCAGGGATGCAGAAGGAAGTTGG + Intergenic
975307518 4:72866629-72866651 CAGTGGATGCAGCACAAGGAGGG + Intergenic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
977019947 4:91746594-91746616 CAGTGGAGGTAGCAGGGGGTGGG + Intergenic
977375785 4:96202201-96202223 CAGGGGATTCCGAAGTAGGTGGG + Intergenic
977787350 4:101052914-101052936 TAGGGGAGGCAGCAGGAATTGGG - Intronic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
979828167 4:125266037-125266059 CAGTGGCGGCAGCAGCAGGTGGG + Intergenic
980463754 4:133149321-133149343 CAGAGGCTGAAGCAGGAGGAAGG + Exonic
981205557 4:142035542-142035564 AAGTGGATGTACCAGGAGGTGGG + Intronic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
982222514 4:153137125-153137147 CACTGGATGCAGAAGGAGTTGGG - Intergenic
982745831 4:159103464-159103486 GAGGGGATGCAGCAGCAGTCGGG + Intergenic
982826663 4:160010981-160011003 CTGGGGATGGAGCAGGTGGTTGG + Intergenic
984220401 4:176967568-176967590 CAGGGGAAGCATGAGGGGGTGGG + Intergenic
985898072 5:2762239-2762261 GAGGGGAGGCAGCAGGAGGCTGG + Intergenic
986009517 5:3699757-3699779 GAGGGGATGCAGCAGGAAATGGG - Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986221994 5:5776354-5776376 CCTGGGATGCAGGAGGAGGGAGG + Intergenic
990232880 5:53734093-53734115 CAGGAGAGGCTGCAGCAGGTTGG + Intergenic
990466170 5:56073914-56073936 CAGGGTATGCACCAGGAGGCTGG + Intergenic
990743177 5:58933197-58933219 CAGGAGATTCTGCAGGAGGCCGG + Intergenic
990801358 5:59607644-59607666 TAGAGGAGGCAGCAGGGGGTAGG + Intronic
991398108 5:66225592-66225614 CAGGGAAAGAAGCAGGAGTTTGG + Intergenic
991514312 5:67416803-67416825 CAAGGGATGGAGCAGGGGGAAGG + Intergenic
991696826 5:69280904-69280926 CAGGGGCTGAGGCAGGAGGATGG - Exonic
992557275 5:77916079-77916101 CACGGCAGGCTGCAGGAGGTGGG - Intergenic
993125423 5:83829513-83829535 CAAGGGATGGAGTAGGTGGTAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
993939770 5:94044683-94044705 CACAGGATGAAACAGGAGGTCGG + Intronic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998707721 5:144782929-144782951 AAGGGTTTGCAGCAGGAGGTGGG + Intergenic
999133155 5:149299745-149299767 CAGGGGCTGCCGCAGGAGGAAGG + Intronic
999328718 5:150658903-150658925 CAAGGGACCCAGCAGCAGGTAGG - Intronic
1000151307 5:158503895-158503917 CAGGGGAGAGAGCTGGAGGTAGG + Intergenic
1000177087 5:158767607-158767629 CAGGGGTGGCACCAGGGGGTGGG + Intronic
1001300719 5:170531782-170531804 CAGGGGGTGGGGCATGAGGTGGG - Intronic
1001977309 5:176010428-176010450 CAGGACATGCAGCAGGAGTATGG - Intronic
1002088748 5:176792453-176792475 CAGGTGCTGCAGCAGGTGTTGGG + Intergenic
1002131806 5:177086769-177086791 GAGGGGGTGTGGCAGGAGGTGGG + Intergenic
1002192125 5:177483787-177483809 CAGGAGATGCAGGAGAAGTTGGG - Intronic
1002240117 5:177833352-177833374 CAGGACATGCAGCAGGAGTATGG + Intergenic
1002290020 5:178194159-178194181 CAGAGGAGGCAGCAGCGGGTGGG - Intergenic
1002560253 5:180076845-180076867 AAGGGGCAGGAGCAGGAGGTGGG - Intergenic
1002761507 6:205988-206010 CAGGTGACTCAGCAGGAGGCTGG - Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003599374 6:7503218-7503240 CATGGGATGCAGGAGAAGGGAGG - Intergenic
1003672454 6:8171809-8171831 CACAGGAGGCAGCAGGAGATGGG + Intergenic
1004160523 6:13208891-13208913 CAGGGTATGCAGCATGATCTCGG + Intronic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005117673 6:22356429-22356451 CAGGGCGTGGAGCAGGGGGTGGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1006081937 6:31572839-31572861 CAGGTGAGGCAGCAGGAGAATGG + Exonic
1006147215 6:31966866-31966888 CAGTGTGTGGAGCAGGAGGTTGG + Intronic
1006152508 6:31996949-31996971 CAGGAGGTGCAGCAGGGCGTAGG - Exonic
1006158814 6:32029686-32029708 CAGGAGGTGCAGCAGGGCGTAGG - Exonic
1006634566 6:35452622-35452644 CAGCGCCTGCAGCAGGAGGCGGG - Exonic
1006719774 6:36142734-36142756 CAGAGGATGAAGCGGGGGGTGGG - Intronic
1007710363 6:43819145-43819167 CAGGGGCTGAGGCAGGAGGCAGG + Intergenic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1009450314 6:63792182-63792204 CTGGGGATGCACCAAGAGGAGGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1012445456 6:99302729-99302751 GAGGCCATACAGCAGGAGGTAGG + Intronic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1013437718 6:110128767-110128789 CAGGCTGTACAGCAGGAGGTGGG + Intronic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1013611853 6:111803160-111803182 CAAGGGATGAAGCAGGAGCTTGG - Intronic
1014214115 6:118736511-118736533 CAGGGTCTGAATCAGGAGGTAGG + Intergenic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1015962177 6:138661280-138661302 CAGGGGCTGGAGTGGGAGGTGGG - Intronic
1016056014 6:139578563-139578585 CAGGTGATGTAGTAGGTGGTGGG + Intergenic
1016241425 6:141935722-141935744 GAGGGGATGCAGATGGAGGTGGG + Intergenic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1017326694 6:153149230-153149252 CAAGAGAGGAAGCAGGAGGTAGG + Intergenic
1018180434 6:161218228-161218250 CAGGGGAGGCAGTAGGTGGGAGG + Intronic
1018225689 6:161626578-161626600 CAGTGGATGCAGCCAGAGTTTGG - Intronic
1018442465 6:163825630-163825652 ATGGGGATGCGGTAGGAGGTGGG + Intergenic
1018452121 6:163919099-163919121 GAGGGGATCCAGCAGCAGGAAGG + Intergenic
1018494773 6:164337919-164337941 CACAGGATGAAACAGGAGGTTGG + Intergenic
1018939973 6:168302623-168302645 AAGGGTTTGCAGCAGGAGGGAGG + Intronic
1019023143 6:168935826-168935848 CAGGGCCTGGAGCAGGAGGGAGG - Intergenic
1019757401 7:2783099-2783121 CAGAGGCTGCAGCAGACGGTGGG - Intronic
1019788298 7:2993594-2993616 CCAGGGACGCAGCAGAAGGTGGG + Intronic
1019812780 7:3176653-3176675 CAGGGGATGAGGCAGGTGGGGGG + Intergenic
1022171884 7:27839091-27839113 AAGGGGATGGAGCTGGAGGTGGG + Intronic
1022360866 7:29655888-29655910 CAGGGGCTGAAGCAGGAGAATGG + Intergenic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1023057206 7:36299971-36299993 CAGGGGATGAAGGAGGGGCTGGG - Exonic
1024039577 7:45541888-45541910 CAGCGGATGCATCAGCAGGCGGG + Intergenic
1024512218 7:50213066-50213088 CAGGGGATGGGCCAGGAGATGGG + Intergenic
1024966331 7:55025280-55025302 CAGAGGATGAAGCAGGAGCAAGG + Intronic
1026511548 7:71031586-71031608 TAAGGGATGGAGCAGGAGTTTGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026775335 7:73227522-73227544 CAGGGAATGGAGCAGGGGCTGGG + Intergenic
1027016192 7:74780893-74780915 CAGGGAATGGAGCAGGGGCTGGG + Intronic
1027071836 7:75165044-75165066 CAGGGAATGGAGCAGGGGCTGGG - Intergenic
1027216295 7:76185953-76185975 TAGGGTTTGCAGCAGGAGCTGGG - Intergenic
1027246532 7:76371339-76371361 CAGAGGATGCAGAGGAAGGTAGG + Intergenic
1027569616 7:79847581-79847603 CAGGGCATGCAACAGGAGTGTGG - Intergenic
1029021094 7:97365065-97365087 CTGGGGATGGGACAGGAGGTAGG - Intergenic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1029270598 7:99374815-99374837 CAGGGGAGCCACCTGGAGGTGGG + Intronic
1029514193 7:101015821-101015843 CCGGGGCTGCAGCGGCAGGTAGG - Intronic
1029742804 7:102500747-102500769 CGGGTGGTGCAGCAGGAGGAGGG - Exonic
1029760794 7:102599908-102599930 CGGGTGGTGCAGCAGGAGGAGGG - Exonic
1031258068 7:119482063-119482085 GAGGGGATGGAGCAGGAAGGTGG - Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032505150 7:132428737-132428759 CAGGGAATGGAGTGGGAGGTAGG - Intronic
1032864738 7:135914313-135914335 CAGGGGCTGCAGCAGGACTCTGG - Intergenic
1032902071 7:136321072-136321094 CAGTGGTGGCAGCTGGAGGTGGG + Intergenic
1032905486 7:136359763-136359785 CAGGTGAGGGAGCAGGTGGTTGG + Intergenic
1033227218 7:139571574-139571596 CAGGGAAGCCAGCAGGAGCTAGG - Exonic
1034012682 7:147547030-147547052 CAGTGGCTGCAGTAAGAGGTGGG + Intronic
1034491738 7:151396500-151396522 AAGGGGATGGGGGAGGAGGTAGG + Intronic
1034875638 7:154722615-154722637 CAGGGGCGGCAGCAGGAGGCAGG + Intronic
1034952076 7:155305389-155305411 GAACGGATGCAGCAGGAGGGAGG - Intronic
1034972433 7:155427580-155427602 CAGGGGCTCCAGCATGGGGTGGG + Intergenic
1035720314 8:1786216-1786238 GAGGGGCTGCAGGAGGAGGGGGG + Exonic
1035781073 8:2228910-2228932 CAGTGGACGCAGCAAGGGGTCGG - Intergenic
1036445998 8:8822397-8822419 CAGGGGATGGAGCGGGAGACAGG + Intronic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1037963309 8:23115795-23115817 AAGGGGCTGCTGCAGGGGGTAGG - Intronic
1037967707 8:23146762-23146784 AAGGGGCTGCTGCAGGGGGTAGG + Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1038245167 8:25848511-25848533 TTGGGCATGCAGCAGGAAGTGGG + Intronic
1038329373 8:26596023-26596045 CAGGGGATGAAAAAGCAGGTAGG + Intronic
1039714717 8:40095040-40095062 AAGGGGAGGCACCAGGAGGCAGG - Intergenic
1040587608 8:48757919-48757941 CAGGGGCTGCTGCGGGAGGAGGG + Intergenic
1041005344 8:53492569-53492591 CAAGGGAAGCAACGGGAGGTAGG + Intergenic
1041455126 8:58050829-58050851 CAGGGCATACACCAGGGGGTGGG + Intronic
1043087530 8:75853352-75853374 TAGGGGATAAAGGAGGAGGTTGG + Intergenic
1043526062 8:81097539-81097561 CAGAGGCTGGAGGAGGAGGTGGG + Intronic
1043981133 8:86640968-86640990 CACAGGATGAAACAGGAGGTTGG + Intronic
1045016971 8:98008688-98008710 CAGGGGGTGCAGAAAGAGGGTGG + Intronic
1046524528 8:115367576-115367598 CAGGCCATGCAGCAAGAGGTGGG + Intergenic
1046625071 8:116568118-116568140 CAGGGCCTGCATCAGGAGCTTGG + Intergenic
1047252745 8:123192975-123192997 CAGGGGAAGCGGCTGGAGGCAGG + Intronic
1047432757 8:124806994-124807016 GCGGGGAGGCAGCAGGAAGTGGG - Intergenic
1047609683 8:126508933-126508955 CAGGAGATGAAACTGGAGGTTGG - Intergenic
1048301655 8:133255712-133255734 CAGGGGATGGGGCAAGAGGCAGG + Intronic
1048318512 8:133380022-133380044 CAGGGGAGGGACCAGGAGGTTGG - Intergenic
1049101301 8:140580686-140580708 CATGGGAGGAGGCAGGAGGTAGG + Intronic
1049277190 8:141725774-141725796 CCAGGGATGAAGCAGGGGGTGGG + Intergenic
1049352413 8:142171311-142171333 CAGGGGCTGCAGCTGCAGGAGGG - Intergenic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049571711 8:143372887-143372909 CAGGGGATGGTGCAGGGGCTTGG + Intronic
1049571817 8:143373155-143373177 CAGGGGATGGTGCAGGGGCTTGG + Intronic
1049622897 8:143606548-143606570 CAGCAGATGCTGCAGGAGCTTGG + Exonic
1049664453 8:143836793-143836815 CAGGGCAGGCAGCAGGATGCAGG + Intronic
1049804136 8:144531301-144531323 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804161 8:144531419-144531441 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804187 8:144531537-144531559 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804201 8:144531596-144531618 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804215 8:144531655-144531677 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804228 8:144531714-144531736 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804242 8:144531773-144531795 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804268 8:144531891-144531913 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804282 8:144531950-144531972 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804295 8:144532009-144532031 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804308 8:144532068-144532090 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1050661648 9:7889748-7889770 CTTGGGATGAAGCAGGAAGTAGG + Intergenic
1050959188 9:11705718-11705740 CAGGGGATGAGATAGGAGGTTGG + Intergenic
1051365962 9:16321660-16321682 CAGTGGATGCAGCTGGAGGCTGG - Intergenic
1051494112 9:17699552-17699574 CAGGGATGGCAGCAGGAGATTGG - Intronic
1053158975 9:35800481-35800503 CAGGTGATGGAGGAGGAGGCAGG + Exonic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053543523 9:38998882-38998904 CAGAGCCTGCAGCAGGAGCTGGG + Intergenic
1053807954 9:41822387-41822409 CAGAGCCTGCAGCAGGAGCTGGG + Intergenic
1054622638 9:67365041-67365063 CAGAGCCTGCAGCAGGAGCTGGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055187576 9:73474673-73474695 CAGGGGATGTGGCCGGAGGGTGG - Intergenic
1055379459 9:75690152-75690174 CACGGGATGAGACAGGAGGTTGG - Intergenic
1055446984 9:76393950-76393972 AAGGGGATGCGGGAGGAGGAAGG + Intronic
1055791660 9:79929067-79929089 CTGGGCATGAAGAAGGAGGTGGG - Intergenic
1056446705 9:86673487-86673509 CATGGGATGAAGCAAGAGCTGGG + Intergenic
1056731061 9:89167104-89167126 CTGGGGGTCCAGCAGGAGGGAGG + Intronic
1057147511 9:92768212-92768234 CAGGAGAAGCAGCTGGATGTCGG - Intergenic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057494484 9:95550106-95550128 CTGGGGATGGAGTAGGAGATGGG + Intergenic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1057870818 9:98715817-98715839 CAGGGGATGCAGCAGGGTTCAGG - Intergenic
1057914910 9:99048011-99048033 CTGGGGATGGAGCCGGAGGTTGG + Intronic
1059328370 9:113518554-113518576 CTGTGGCTGAAGCAGGAGGTTGG + Intronic
1059443585 9:114324629-114324651 CTGGGCATGCAGCAGGGGCTGGG + Intronic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1059730289 9:117050450-117050472 CAGGGGAGGAAGCAGGAGTAGGG - Intronic
1060418990 9:123454158-123454180 CTGGGGATGCAGCAGGGAGCAGG - Intronic
1060522249 9:124300486-124300508 CAGGTGAGACAGCAGGAGGCGGG + Intronic
1060797577 9:126522949-126522971 CAGTGGATGGAGCAGGGGTTGGG - Intergenic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061120218 9:128637302-128637324 CAGGGGCTGCAGCAGGAAGGTGG + Intronic
1061405976 9:130393306-130393328 CAGGGTATGGAGCAGGGGGTGGG + Intronic
1061506043 9:131032340-131032362 CAGGGGACCCGGCAGGAGGTGGG - Intronic
1061613785 9:131765944-131765966 CAGGGCTGGGAGCAGGAGGTCGG - Intergenic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1062160970 9:135079643-135079665 CAGAGGCTGCAGCAGGAAGAAGG + Intronic
1062192308 9:135254321-135254343 CAGTGGAGGCAGCAGGTGCTGGG - Intergenic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1185877407 X:3712599-3712621 CAGGGGCTGCAGGAGCAGCTGGG - Intronic
1185893964 X:3842854-3842876 CAGGGGCTGCAGGAGCAGCTGGG - Intronic
1185899081 X:3881278-3881300 CAGGGGCTGCAGGAGCAGCTGGG - Intergenic
1185904198 X:3919707-3919729 CAGGGGCTGCAGGAGCAGCTGGG - Intergenic
1186397561 X:9225171-9225193 CATGGGGGGCAGCAGAAGGTGGG - Intergenic
1186594002 X:10960963-10960985 AAGGAGATGCAGCAGGAATTAGG - Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187200969 X:17133326-17133348 CTGGGGATGCAGCAGTGCGTGGG + Intronic
1187981779 X:24765065-24765087 CAGGTGAGGGAGCAGCAGGTAGG - Intronic
1189362237 X:40361872-40361894 CAGTGGCTGCAGGAGGAAGTGGG + Intergenic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1190015124 X:46820031-46820053 CAGGGGATAGAGCACGAAGTGGG + Intergenic
1190418626 X:50205548-50205570 CAGTGGCTGCGGCAGGAGGATGG + Intronic
1190465459 X:50721609-50721631 CACAGGATGAGGCAGGAGGTCGG - Intronic
1191885639 X:65885042-65885064 CTGAGGATGCAGCAGGAAGATGG + Intergenic
1192125608 X:68498589-68498611 CGGCGGAGGGAGCAGGAGGTTGG + Exonic
1193601061 X:83508777-83508799 CAGAGGCGGCAGCTGGAGGTGGG - Exonic
1194460381 X:94159719-94159741 CAGGAGATGGAGCAGTAGCTGGG + Intergenic
1195616521 X:106916806-106916828 GAGGGGCTGAAGCAGGAGGCTGG + Intronic
1196562323 X:117164923-117164945 ATGGGGGTACAGCAGGAGGTTGG + Intergenic
1197280888 X:124534656-124534678 CAGGGGATCTAGCAGCAGGTGGG + Intronic
1198267318 X:135021913-135021935 CAGGGGCGGCAGCAGGAGCCTGG + Exonic
1198268570 X:135032908-135032930 CAGGGGCGGCAGCAGGAGCCTGG - Exonic
1198270401 X:135051562-135051584 CAGGAGCTGCAGCAGGAGCCTGG + Exonic
1198300710 X:135331931-135331953 CAGAGGATGCAGCTGGCTGTAGG + Intronic
1198643053 X:138777513-138777535 CAGAGGATGCTGGAGCAGGTGGG + Intronic
1200079113 X:153566794-153566816 CAGGGGACGCAGCGGGAGTTGGG - Intronic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1200259098 X:154602462-154602484 CGGGGGCAGTAGCAGGAGGTGGG + Intergenic
1202378867 Y:24259795-24259817 GAGGGGAAGCAGCAGGACCTGGG - Intergenic
1202491915 Y:25410326-25410348 GAGGGGAAGCAGCAGGACCTGGG + Intergenic