ID: 1187058363

View in Genome Browser
Species Human (GRCh38)
Location X:15762334-15762356
Sequence TGTCAGAGTAAACCAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187058361_1187058363 1 Left 1187058361 X:15762310-15762332 CCGAAGGAAGAGGATTATCTGCT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1187058363 X:15762334-15762356 TGTCAGAGTAAACCAGAGGCAGG 0: 1
1: 0
2: 0
3: 54
4: 195
1187058358_1187058363 18 Left 1187058358 X:15762293-15762315 CCGGCTTTCAGCAATTACCGAAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1187058363 X:15762334-15762356 TGTCAGAGTAAACCAGAGGCAGG 0: 1
1: 0
2: 0
3: 54
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187058363 Original CRISPR TGTCAGAGTAAACCAGAGGC AGG Intronic
900151637 1:1181512-1181534 TGTCACAGGCAACCAGGGGCGGG - Intronic
901848785 1:12001901-12001923 TGGCAGTGAAAACCAGAGTCTGG + Intronic
903340918 1:22653728-22653750 TTTATCAGTAAACCAGAGGCAGG + Intronic
903512739 1:23888620-23888642 TGTAAGAGTAAAAGAGAAGCGGG + Intronic
905327932 1:37171140-37171162 TGTCCAAATAAACCACAGGCAGG + Intergenic
905348643 1:37328911-37328933 TGTCAGGGTAAACCAGGGGAAGG + Intergenic
905572113 1:39014324-39014346 AGGCAGAGCAGACCAGAGGCAGG + Intergenic
905629870 1:39512448-39512470 AGTCAGAGTAAACCAGGGCCAGG + Intronic
905667889 1:39773742-39773764 AGTCAGAGTAAACCAGGGCCAGG - Intronic
905914243 1:41674087-41674109 TGTCAGATGAAGCCAGAAGCAGG + Intronic
907704609 1:56821532-56821554 TGTAAAAGTAAACAAGAGTCTGG + Intergenic
909375369 1:74935198-74935220 TGTAACAGAAAACCACAGGCTGG - Intergenic
912048987 1:105499363-105499385 TGTCAAAGAACACCAGAGCCAGG - Intergenic
913187805 1:116385828-116385850 TGTAAGAGTAGAGAAGAGGCCGG + Intronic
914433939 1:147643429-147643451 TGGCAGAGTATACCTAAGGCAGG + Exonic
914464819 1:147917591-147917613 TATCAGAGAAAAACAGATGCTGG - Intergenic
916587840 1:166164326-166164348 AGTCAGAGAAAGCCACAGGCAGG - Intronic
917369848 1:174280727-174280749 TGGGAAAGTAAACTAGAGGCTGG + Intronic
919305943 1:195838052-195838074 TGGCAGTGCAAGCCAGAGGCTGG + Intergenic
919845573 1:201640100-201640122 AGGCAGAGAAAACTAGAGGCTGG - Intronic
920264335 1:204710652-204710674 TGTCAGAGTGGCCTAGAGGCAGG + Intergenic
921376097 1:214475464-214475486 TTTGAGAGTAAACCAGAGTCAGG - Intronic
921388436 1:214595070-214595092 GGTCAGATTATACCCGAGGCTGG + Intergenic
921685090 1:218080931-218080953 TGTGCAAGTGAACCAGAGGCGGG + Intergenic
922188946 1:223300124-223300146 GGTCAGAGCAGACCAGGGGCAGG + Intronic
1063058181 10:2525060-2525082 TGGCAGAGCAAACCAGGAGCAGG - Intergenic
1063712759 10:8495471-8495493 ATACAGAGTAAACGAGAGGCCGG - Intergenic
1066237591 10:33501594-33501616 TGTAAGAGAGAGCCAGAGGCTGG + Intergenic
1066638916 10:37535980-37536002 TGTTAGAGTACAGCAGGGGCTGG + Intergenic
1069085971 10:64140068-64140090 TGGCAGGGTATATCAGAGGCTGG - Intergenic
1074177024 10:111018039-111018061 TGTTAGAGTAATCCAGATGATGG + Intergenic
1076090767 10:127683718-127683740 TCCCTGAATAAACCAGAGGCTGG + Intergenic
1082825102 11:57571785-57571807 TGTGAGACTAACCCAGAGGAAGG - Intergenic
1083014960 11:59443729-59443751 TGTCAGAGCAAGACAGAGCCAGG - Exonic
1090000509 11:122952588-122952610 TATCACAGAAAACCAGAGCCAGG - Intronic
1091331030 11:134730952-134730974 TCTCAGCCTAAACAAGAGGCAGG + Intergenic
1092667656 12:10821783-10821805 GAGCAGAGTATACCAGAGGCTGG - Intergenic
1095616227 12:44192766-44192788 TGTCACAGTACAGCAGAGCCAGG - Intronic
1096626248 12:52897774-52897796 TGTCAGGGAAAACCAGGAGCAGG + Intronic
1100967878 12:100032832-100032854 TCTCAGATTAAAACAGTGGCTGG - Intronic
1105565731 13:21545712-21545734 GGACAGAGTATACTAGAGGCTGG + Intronic
1110151268 13:72257487-72257509 TTACAGAGAAAACCAGAGGAAGG - Intergenic
1110231853 13:73175433-73175455 TCTCATAGTAAATCAGGGGCAGG - Intergenic
1110424738 13:75354332-75354354 TGGCAGATTAAGCCAGTGGCAGG + Intronic
1110655930 13:77998946-77998968 TGTCAGGGTTTTCCAGAGGCTGG - Intergenic
1111728227 13:92040250-92040272 TGAGAGAGGAAACCAGAGACTGG - Intronic
1113925974 13:113941862-113941884 GGTGAGAGTAAAGCAGTGGCAGG - Intergenic
1115569834 14:34655988-34656010 TAGCAGACTAAAACAGAGGCTGG + Intergenic
1115964977 14:38877902-38877924 TGATAGAATAAACCAGAGGGTGG - Intergenic
1120372541 14:83654956-83654978 AGCAAAAGTAAACCAGAGGCTGG + Intergenic
1120944885 14:89984896-89984918 TGTGAGAGTAACCCAGTGGGAGG - Intronic
1121467266 14:94124028-94124050 TGTAAGAGAAAACCACAGACTGG - Intergenic
1121716215 14:96077984-96078006 TGTCAGGGGAACCCAGAGGGAGG - Intronic
1121972697 14:98373212-98373234 TGCCAGAGGCTACCAGAGGCTGG + Intergenic
1122104019 14:99437420-99437442 TGGCGGAGTAGCCCAGAGGCAGG - Intronic
1124230242 15:27938754-27938776 TGTCAGAGAAAGACAGTGGCAGG + Intronic
1125202754 15:37114822-37114844 TTTTAGAGGAAAACAGAGGCAGG + Intergenic
1127080641 15:55375367-55375389 TCTCTAATTAAACCAGAGGCAGG + Intronic
1128411837 15:67407123-67407145 TGTCTGGGTAAAGCATAGGCTGG - Intronic
1129268678 15:74408351-74408373 TGCCAGAGCCAACCAGAAGCTGG + Intergenic
1129317383 15:74753235-74753257 TGTCTTCGTAAACCAGTGGCAGG + Exonic
1131062749 15:89414110-89414132 TGTCAGTGTGAGCCAGAGGATGG - Intergenic
1133856993 16:9559091-9559113 TGTCATACAAAACCTGAGGCTGG + Intergenic
1135916603 16:26610680-26610702 TGTCTGAGAAACCCTGAGGCAGG - Intergenic
1137687574 16:50397245-50397267 AGACAGAGTATAGCAGAGGCAGG - Intergenic
1138082046 16:54099881-54099903 TTTCAGAGGAAACCAGACTCAGG - Intronic
1139026602 16:62825298-62825320 TGTCAGAGAAACCCTGAGGTGGG + Intergenic
1140729586 16:77843891-77843913 TGGCAGAGGAAGGCAGAGGCAGG - Intronic
1142269101 16:89079877-89079899 TTTCTGAGAAACCCAGAGGCTGG - Intergenic
1143557929 17:7674116-7674138 GGTCAGAGGCAAGCAGAGGCTGG + Intronic
1143719974 17:8802583-8802605 TGACAGAGTAAGCAAGGGGCAGG + Intergenic
1143746104 17:8995348-8995370 TGACAGAGTATAACAAAGGCTGG - Intergenic
1144302396 17:13934065-13934087 AGACAGGGTAAGCCAGAGGCAGG + Intergenic
1144398070 17:14865185-14865207 TGTCAGAGTAAGAAAGTGGCAGG - Intergenic
1146986604 17:37226054-37226076 TGTGATAGTAAACCAGGGTCAGG - Intronic
1148155000 17:45418664-45418686 TGCCTGAGTCAAGCAGAGGCTGG + Intronic
1150386702 17:64767400-64767422 TGCCTGAGTCAAGCAGAGGCTGG + Intergenic
1150915328 17:69430758-69430780 TGACAGAGAAAACCAGTAGCTGG - Intronic
1153523606 18:5975087-5975109 TGTCAGGGTAGAGCAGAGGTGGG - Intronic
1154104058 18:11504997-11505019 TGCCAGAGAAAACCAGATCCTGG + Intergenic
1155833056 18:30542493-30542515 TGTTATAGTAGACCAGAGGTTGG - Intergenic
1156929560 18:42625369-42625391 TGTAAGAGTAAGGCAGAGGCCGG + Intergenic
1157506956 18:48233368-48233390 TGTAAGAGAATACCAGAGACTGG - Intronic
1157510139 18:48265351-48265373 TGTCAGAGAAAACCATAGCCAGG - Intronic
1158872458 18:61701468-61701490 TGACAGAGGAAACTAGAGGCAGG + Intergenic
1159302862 18:66598135-66598157 TGTCAGAATATAACAGATGCTGG + Intronic
1160938119 19:1607070-1607092 TGTAAGAGTTCACCAGTGGCCGG + Intergenic
1161670565 19:5605987-5606009 TGTGCGAGGAAACCAGAGGCTGG + Intronic
1162884231 19:13684477-13684499 TCTAAAAGTAAACCAAAGGCTGG + Intergenic
1164753056 19:30670222-30670244 TCTCAGAGGAAGCCTGAGGCTGG - Intronic
1166384267 19:42371408-42371430 TGTCAGAATAACACAGAGACGGG + Exonic
1168683768 19:58335715-58335737 TCTCAGAGGAAACCAGACGAGGG + Intronic
925005540 2:440548-440570 TGACAGAGTAAGCCAGCAGCTGG - Intergenic
925879792 2:8342855-8342877 TGTCAGAGGGAAGCAGAGGGCGG - Intergenic
926335994 2:11863315-11863337 TGTCAGATGAAACAGGAGGCGGG + Intergenic
926449254 2:12982464-12982486 AGTCAGTGTAAACCAGCTGCTGG + Intergenic
927429635 2:23016409-23016431 TGTTAGAGTAAATCAGATTCAGG - Intergenic
927487613 2:23499465-23499487 TGTCAGACTCAAGCAGTGGCTGG + Intronic
927587084 2:24317742-24317764 TTTCAGTCTAAATCAGAGGCTGG - Intronic
927994085 2:27470475-27470497 AGCCAGAGAAAACGAGAGGCAGG - Intronic
928009923 2:27597695-27597717 TGTCAGAGAAAGAGAGAGGCTGG + Intronic
929634769 2:43507444-43507466 GGTCAGAGTGAATTAGAGGCAGG + Intronic
929935894 2:46294507-46294529 TGAGAGTGTAAACCAGATGCAGG - Intronic
930389361 2:50741185-50741207 TGACAGAATAAAACAGAGTCTGG + Intronic
930886527 2:56332763-56332785 TGTCAGATTCAACCAGTGGTGGG - Intronic
931379636 2:61740797-61740819 TGTAAGACTAGACCATAGGCAGG + Intergenic
932915990 2:75858735-75858757 TGTGAGAGAAAGCCAGTGGCAGG - Intergenic
933987831 2:87607292-87607314 TGTCCAAGTAAACCACAGGAAGG + Intergenic
936276522 2:111102468-111102490 TGCCAGAGAAACTCAGAGGCTGG - Intronic
936306010 2:111343516-111343538 TGTCCAAGTAAACCACAGGAAGG - Intergenic
937093416 2:119221639-119221661 TGGCAGAGGACACCAGAGTCTGG + Intergenic
937989741 2:127655471-127655493 TGTTAGAGGAAAGCAGAGGCAGG - Intronic
940888645 2:159013824-159013846 TCTCAGAGTTATACAGAGGCTGG + Intronic
943633794 2:190282734-190282756 TGAAAGAGTAAACAACAGGCTGG - Intronic
944985229 2:205168676-205168698 TGGCAGAGCAACCCAGAGGAGGG - Intronic
946803738 2:223449271-223449293 TTTCAGGGTTAACAAGAGGCAGG - Intergenic
947598730 2:231431263-231431285 TGTCAGTGTAAACAAGAGCAGGG + Intergenic
948610839 2:239165749-239165771 TGTAAAAGGAAACAAGAGGCAGG - Intronic
1168797101 20:618305-618327 TGTCAGGGTCAACCTGAGTCAGG - Intergenic
1169226153 20:3858245-3858267 TCTCAGGGTAAACCAGGGGAGGG - Intronic
1173647415 20:44642106-44642128 TGCCAGAGTAAAGCAGAGCTGGG - Intronic
1174197682 20:48785279-48785301 TGTCAGAGGAGACCCCAGGCAGG - Intronic
1175045269 20:56099094-56099116 TGTCAGAGAAAACCAGAGCATGG + Intergenic
1175933807 20:62505945-62505967 TGTCAGAGTCAGCCTGGGGCCGG - Intergenic
1176277319 20:64279742-64279764 AGGCAGGGTAAAACAGAGGCTGG + Intronic
1177775695 21:25563421-25563443 TATCAAATTAAACCACAGGCAGG - Intergenic
1180228740 21:46413700-46413722 TTTCAAAGTAAAACAGACGCTGG - Intronic
1182071132 22:27464513-27464535 TGTCACAGAATTCCAGAGGCAGG + Intergenic
1184379851 22:44138428-44138450 GGTCAGGGTAAAGGAGAGGCTGG + Intronic
1184727445 22:46355196-46355218 TGTCAGAGTGGGCAAGAGGCAGG - Intronic
950892177 3:16413830-16413852 TGTTAGAGCTAACTAGAGGCAGG + Intronic
952874958 3:37937002-37937024 TGTCAGAGAAAACCAGACCTGGG + Intronic
955336960 3:58094814-58094836 TGTCTGTGTAAACCTGTGGCAGG + Exonic
955828162 3:62971318-62971340 TGTGAGACTAAAGCAGAGGAGGG - Intergenic
957346275 3:78964962-78964984 TCTCAGAGTGAAACATAGGCTGG - Intronic
957416998 3:79917812-79917834 GGTCAGAGGAACCCAGAGGTAGG + Intergenic
960198457 3:114800430-114800452 TGTCAGAGTCTACCACAGTCTGG - Intronic
960786990 3:121384365-121384387 TTTAAGAGTAATTCAGAGGCTGG + Intronic
961024710 3:123544230-123544252 TGTCAAAGTACTGCAGAGGCTGG + Intronic
962242724 3:133764886-133764908 TGTGAGGATACACCAGAGGCAGG + Exonic
962770262 3:138604782-138604804 TTTCAGAGTACAGCAGAGTCTGG - Intergenic
967296922 3:187974288-187974310 TGGCTGATGAAACCAGAGGCAGG - Intergenic
967718951 3:192794862-192794884 TTTCAGAGAAAATGAGAGGCAGG - Intergenic
971663191 4:29447037-29447059 TGTCAGAGTGAATCAGAGGGTGG - Intergenic
975351308 4:73350505-73350527 TGTAAAAGAAAACCTGAGGCTGG + Intergenic
975839193 4:78455944-78455966 TCTCAGAGTAATCCAAAGGCAGG + Intronic
977025958 4:91820187-91820209 TGTGAGAGGAAACCAGGGGGAGG - Intergenic
977170439 4:93754906-93754928 TGTCAGAGGGACCAAGAGGCTGG - Intronic
979160163 4:117449280-117449302 ATTCAGAGTAAAGCAGAGGAAGG + Intergenic
981780850 4:148427505-148427527 GGTCAGAGTCAAGCAGAGACAGG + Intronic
984830162 4:183965710-183965732 TGACAGAGGAAACCAGTGGCGGG + Intronic
985207772 4:187558842-187558864 AGTCACTTTAAACCAGAGGCTGG + Intergenic
986463596 5:7998192-7998214 TGTCACAGTAAATCAGAGAGCGG + Intergenic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
989267909 5:39499029-39499051 TGTAAGAGTAGAGCACAGGCAGG + Intergenic
989356491 5:40549266-40549288 TGTAAGAGTATACTTGAGGCTGG - Intergenic
990479903 5:56200138-56200160 TGTCAGAATAAACCAAATTCAGG + Intronic
991032068 5:62092699-62092721 TATCAGAGAAAATCAGAGACAGG - Intergenic
996775520 5:127128437-127128459 CATCAGAGCAAACCAGAGGGAGG + Intergenic
996889568 5:128402069-128402091 TTTCAAAGCAAATCAGAGGCTGG + Intronic
999823780 5:155254647-155254669 TCACAGACTAAGCCAGAGGCAGG - Intergenic
1001049777 5:168404842-168404864 GGTCAGACCAAACCAGAGACAGG - Intronic
1001910539 5:175513867-175513889 TGGCAGAGGGAACCACAGGCAGG + Intronic
1002113876 5:176942134-176942156 TTTAAGAGTGTACCAGAGGCTGG - Intronic
1002467928 5:179417080-179417102 TGAAAGAGCAAACCAGGGGCTGG + Intergenic
1003234371 6:4282525-4282547 TGTTAGAGGAAACCAGAGTCGGG + Intergenic
1003696893 6:8416050-8416072 TCTCATAGTCAACCAGAGCCAGG - Intronic
1005368522 6:25105209-25105231 TGTCTGAGGCAACCAGAGGCTGG + Intergenic
1005383531 6:25262655-25262677 GGACAGAGGATACCAGAGGCTGG + Intergenic
1009559197 6:65217748-65217770 TGTAAAAATAAACCAGAAGCTGG + Intronic
1010115841 6:72309253-72309275 AGTCATAGTAAACCAAAGGTAGG + Intronic
1011253636 6:85399554-85399576 TTTCAGAGGAACTCAGAGGCAGG - Intergenic
1015058707 6:128935930-128935952 TGTCAAAGGAAACCAGATGAAGG + Intronic
1016227183 6:141752589-141752611 TGACATGGTAAAACAGAGGCAGG + Intergenic
1018416760 6:163608278-163608300 TCTCAGAGTGACGCAGAGGCTGG - Intergenic
1018716905 6:166540152-166540174 TCTTAGAGTAAAACAGAGGGTGG - Intronic
1019561924 7:1663795-1663817 TGACAGAGGCAAACAGAGGCGGG + Intergenic
1022156405 7:27665401-27665423 TGTCAGAGAAAACCAAAGAGAGG + Intergenic
1022492470 7:30831526-30831548 AGGCAGAGTGATCCAGAGGCTGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1026240698 7:68572460-68572482 TTTAAGAATAAACTAGAGGCTGG - Intergenic
1026760101 7:73120247-73120269 TGTTACAGAAAACCATAGGCTGG - Intergenic
1027036443 7:74929059-74929081 TGTTACAGAAAACCATAGGCTGG - Intergenic
1028670865 7:93398707-93398729 TGTCAGTGTAAACAAGAGCAGGG - Intergenic
1029393426 7:100290389-100290411 TGTTACAGAAAACCATAGGCTGG + Intergenic
1033874717 7:145801442-145801464 TGTAAGAGGTACCCAGAGGCGGG + Intergenic
1034964302 7:155382232-155382254 TGTCAGAGAAAAACAGAAGTGGG + Exonic
1038588435 8:28812572-28812594 TTTTAAAGTAAACCAGAGACTGG + Intronic
1039794280 8:40898649-40898671 TGTCAGAATAAACCAAAGTGAGG - Intergenic
1040399662 8:47035973-47035995 TGTCACAGAAAAACAGAAGCAGG + Intergenic
1043643484 8:82486702-82486724 TTTCAGGGTATACCAGAGGAGGG - Intergenic
1043963442 8:86444902-86444924 TGTAAGGGAATACCAGAGGCTGG + Intronic
1044449770 8:92321024-92321046 TGTTTGAGGAAACCAGTGGCAGG - Intergenic
1045417856 8:101984976-101984998 TGACAGAGGACACCAGAGTCAGG + Intronic
1046709899 8:117499168-117499190 TGGCAGAGGAAACAAGCGGCTGG + Intergenic
1049160751 8:141096079-141096101 GGACAGAGTGAACCAGAGGACGG + Intergenic
1049291022 8:141802032-141802054 GGTCAGAGGAAGGCAGAGGCAGG - Intergenic
1050157401 9:2681797-2681819 TGTTATAGAAAAACAGAGGCTGG - Intergenic
1050608001 9:7321225-7321247 TGGCAGAGAAAATAAGAGGCAGG + Intergenic
1052752326 9:32504225-32504247 GGTTAGAGTAAACGAGATGCTGG + Intronic
1053280208 9:36815706-36815728 TCACAGAGTGAGCCAGAGGCAGG - Intergenic
1055052600 9:71995335-71995357 TGACAGAGGAAAACAGAGACTGG + Intergenic
1058444223 9:105040298-105040320 TGTAACAGTATACCTGAGGCTGG + Intergenic
1058840812 9:108907148-108907170 TGTCAGTGAAAACCAGAGGTGGG - Intronic
1059461409 9:114432955-114432977 GGTCAGTGGAAGCCAGAGGCAGG - Intronic
1061411217 9:130422749-130422771 TGTGACAATAACCCAGAGGCAGG - Intronic
1061698066 9:132392968-132392990 TGTCAGAGTAAAACACATGCTGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1185606287 X:1368840-1368862 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606328 X:1369072-1369094 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606371 X:1369307-1369329 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606412 X:1369542-1369564 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606453 X:1369774-1369796 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606496 X:1370009-1370031 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606536 X:1370239-1370261 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606579 X:1370471-1370493 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606624 X:1370705-1370727 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606664 X:1370937-1370959 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606706 X:1371172-1371194 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606749 X:1371404-1371426 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606791 X:1371636-1371658 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606836 X:1371870-1371892 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606880 X:1372104-1372126 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606922 X:1372339-1372361 TGTCACAGAATACCAGAGGCTGG - Intronic
1185606965 X:1372571-1372593 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607007 X:1372803-1372825 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607052 X:1373037-1373059 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607096 X:1373271-1373293 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607139 X:1373501-1373523 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607179 X:1373736-1373758 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607220 X:1373971-1373993 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607264 X:1374203-1374225 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607305 X:1374435-1374457 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607348 X:1374670-1374692 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607388 X:1374902-1374924 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607431 X:1375134-1375156 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607476 X:1375368-1375390 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607519 X:1375600-1375622 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607564 X:1375834-1375856 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607609 X:1376068-1376090 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607653 X:1376298-1376320 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607693 X:1376533-1376555 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607734 X:1376768-1376790 TGTCACAGAATACCAGAGGCTGG - Intronic
1185607780 X:1377000-1377022 TGTCACAGAATACCAGAGGCTGG - Intronic
1185682041 X:1896929-1896951 TGTCACAGAATACCAGAGGCTGG + Intergenic
1185721884 X:2388838-2388860 TGTCACAGAATACCATAGGCTGG - Intronic
1187058363 X:15762334-15762356 TGTCAGAGTAAACCAGAGGCAGG + Intronic
1187300739 X:18047100-18047122 TGTGAGAGTAAAACAAATGCTGG - Intergenic
1187320765 X:18235572-18235594 TGTCATGTTAAACCAGTGGCTGG + Intergenic
1199045227 X:143162503-143162525 AGCCATAGTAAAACAGAGGCAGG - Intergenic