ID: 1187060101

View in Genome Browser
Species Human (GRCh38)
Location X:15778495-15778517
Sequence ATGGATAAAGAGATCAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187060097_1187060101 8 Left 1187060097 X:15778464-15778486 CCTCAATAATTAAATAGCGTGTT 0: 1
1: 0
2: 1
3: 14
4: 104
Right 1187060101 X:15778495-15778517 ATGGATAAAGAGATCAATCAAGG 0: 1
1: 0
2: 3
3: 17
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187060101 Original CRISPR ATGGATAAAGAGATCAATCA AGG Intronic
903253533 1:22074523-22074545 GTGGGTAAAGGGAGCAATCAGGG - Intronic
904888193 1:33757682-33757704 ATAGATAAAGAGTTCAATTTTGG - Intronic
905130253 1:35749735-35749757 ATGGATAAAGAAAATAATGATGG - Exonic
907123037 1:52024448-52024470 ATGGAGAGAGAAATGAATCAAGG - Intronic
908814428 1:68017145-68017167 ATAGATAAAGAGATAAAGAATGG - Intergenic
910508915 1:87981856-87981878 ATGGATAAATGAATCAATAAGGG + Intergenic
910562851 1:88611013-88611035 AAGGATAAAGAGAAAATTCAGGG - Intergenic
910755818 1:90689345-90689367 ATGGAAAAAGAAACCCATCAAGG + Intergenic
911386638 1:97183674-97183696 ATGTATATACAGATCAATCCAGG + Intronic
912102028 1:106221252-106221274 ATCCATAAGGAGATCAAACAAGG + Intergenic
915097604 1:153474459-153474481 ATTGTGAAATAGATCAATCATGG + Intergenic
915174126 1:154000617-154000639 CTGGACAAAGAGATGATTCATGG + Intronic
915255896 1:154628177-154628199 ATGACTAAGGAGTTCAATCAAGG - Intergenic
918468211 1:184843248-184843270 AGAGAAAATGAGATCAATCAGGG - Intronic
918481909 1:184987433-184987455 ATGGGAAAAGAGAGCAATAAAGG - Intergenic
920700584 1:208215517-208215539 GTGGATAAAGAGATGGATGAAGG + Intronic
1063063571 10:2585416-2585438 ATGGAGGAAGTGTTCAATCAAGG - Intergenic
1063774711 10:9249123-9249145 AGTGATAAAGGGATCAATGAAGG + Intergenic
1064872705 10:19956659-19956681 ATGGAATAAAAGATCAATGAAGG + Intronic
1068606159 10:59007534-59007556 ATGTGTAAAGAGATAAATAAAGG + Intergenic
1069644476 10:69982902-69982924 ATAGATAAAGATATAAATTAAGG + Intergenic
1074170884 10:110935716-110935738 ATGGACTAAGAGATAAGTCAAGG + Intronic
1074376846 10:112947810-112947832 ATGGATAAAGTTACTAATCATGG + Intergenic
1078555284 11:12320470-12320492 GTGGATAAAGAAAACAATGATGG - Intronic
1079339653 11:19601521-19601543 ATGGATAAATAAATGAATAAAGG - Intronic
1079573899 11:21979272-21979294 ATGCATCAAGTGATCAATAAGGG - Intergenic
1079809274 11:24975541-24975563 ATGGATAAATGGAACAATAATGG + Intronic
1080208082 11:29754435-29754457 AAGGACAAAGAGATAAATCATGG + Intergenic
1080964593 11:37199553-37199575 ATGGATACAGACAGAAATCAAGG + Intergenic
1082826292 11:57582114-57582136 ATGGAGAAAGAGATACACCAAGG - Intergenic
1086487097 11:87317814-87317836 AAGGATGAACAGATCTATCAGGG + Intronic
1086811373 11:91314592-91314614 ATGGATAAAGATATCTATTCTGG - Intergenic
1087821647 11:102719141-102719163 ATGGAGAAAGAGAGCAATAAGGG - Intronic
1087868030 11:103257583-103257605 ATGGATCAAGAGATCAGTAGGGG - Intronic
1088063264 11:105683138-105683160 ATGTATACAGAGAAAAATCATGG - Intronic
1090296963 11:125596918-125596940 ATGGATAAAGACTTTATTCAGGG + Intronic
1091165358 11:133470860-133470882 GTGGCTAGAGAGATCATTCAGGG + Intronic
1093361412 12:18233764-18233786 AATGATAAAGACATCAATCCAGG - Intronic
1093852398 12:24056494-24056516 ATGGAGAAATAGAGCAACCATGG - Intergenic
1095757723 12:45788406-45788428 ATGGATAATGAAATCAAACTTGG - Intronic
1096527673 12:52221641-52221663 ATCCATGAAGATATCAATCACGG - Intergenic
1100021014 12:90069723-90069745 ATGGAAAAAGGAACCAATCATGG + Intergenic
1100669774 12:96799050-96799072 ATGGATATAGATATGAATAAAGG - Intronic
1100687855 12:97006149-97006171 ATGGAGAAAGAGATTAATACTGG - Intergenic
1100921699 12:99495512-99495534 ATGGGCAAAGAGAGAAATCAAGG - Intronic
1101098101 12:101364485-101364507 ATGGTTAAAGAGAAAAGTCAGGG + Intronic
1101482275 12:105109390-105109412 AGGGATAAAAAGATAAAACAAGG + Intronic
1101500144 12:105296622-105296644 ATAGATAAATAGATAAATAATGG + Intronic
1103031439 12:117616858-117616880 AAGAATAAAAAGATGAATCATGG - Intronic
1107346632 13:39468563-39468585 AAGGATGAAGAGATACATCATGG - Intronic
1108716390 13:53082346-53082368 ATGCATAGAAAGATCAATGAGGG - Intergenic
1108840665 13:54610560-54610582 GTGGATAAAAAGAACAATTAAGG + Intergenic
1110703615 13:78578830-78578852 ATGGCTAAAGAGAATAAGCATGG + Intergenic
1110725670 13:78820077-78820099 ATAAATAAAGAGATTGATCATGG + Intergenic
1111024765 13:82505449-82505471 TTGGATGAAGAGATCAGTTAAGG - Intergenic
1111555318 13:89873579-89873601 ATGGATAAGGAAATAAATCATGG + Intergenic
1111769328 13:92576771-92576793 TTGGAGAAAGAGATCAATGTGGG - Intronic
1113251531 13:108458467-108458489 AGGGAGAAAGAGAGCAATAAAGG - Intergenic
1113780227 13:112972544-112972566 ATGGATAAATAGATAAATGGAGG + Intronic
1114818751 14:25991159-25991181 TTTGATAAAGAGAACAATAATGG - Intergenic
1115708959 14:36028986-36029008 ATGGAAAAAGAAATAAATAATGG - Intergenic
1116056286 14:39867716-39867738 ATGCATAAAGAAATCAATTCTGG - Intergenic
1116063835 14:39957883-39957905 ATGTATAAATATATCAACCAAGG - Intergenic
1116321688 14:43475196-43475218 TTGGATATAGAGCTCAATCTGGG + Intergenic
1118170179 14:63380884-63380906 ATTGATAAAAAGAGCAATGAGGG - Intronic
1119004921 14:70915952-70915974 AAGGATGAAGGGATAAATCATGG + Intronic
1120061932 14:79993548-79993570 ATTTAAAAAGAAATCAATCATGG - Intergenic
1120312930 14:82854436-82854458 ATGAATAAAGAAATAAATCATGG - Intergenic
1121487416 14:94328673-94328695 ATGGATTAAAAGAACAATCTTGG - Intergenic
1123919251 15:25059015-25059037 ATGGAAACAGAGGTCACTCATGG + Intergenic
1123921435 15:25072588-25072610 ATGGAGATGGAGATCAATCATGG + Intergenic
1124442162 15:29694315-29694337 AGGAATAAAGAGAGCAATAAAGG + Intergenic
1124575125 15:30901438-30901460 ATGGATGAACAGATAAAGCATGG - Intergenic
1125772934 15:42183770-42183792 TTGGATAAAGAGACAAAACAAGG - Intronic
1127563507 15:60163870-60163892 ATAGATGAAGAGATCCATGAAGG + Intergenic
1128032454 15:64493168-64493190 ATGGATACAGAGATCTCTCGGGG + Intronic
1128828068 15:70739461-70739483 ATGAATAAAGGGATGAATTAAGG + Intronic
1131457527 15:92594840-92594862 ATCAATAAAGAAAACAATCACGG + Intergenic
1131485589 15:92817404-92817426 ATGGTGAAAGAGATCAGTGATGG - Intergenic
1131668914 15:94598801-94598823 ATGGATGAAGAGATAAATGATGG - Intergenic
1131792357 15:95978969-95978991 ATGAATAAAGAAATGAATAAAGG - Intergenic
1131886436 15:96919516-96919538 ATGGATAAATGGATAAACCATGG - Intergenic
1132194742 15:99905248-99905270 TTGGAGAAAGAGATCAATGTGGG + Intergenic
1133530892 16:6653886-6653908 ATGGATAAAAAGATGAATTTGGG + Intronic
1133919759 16:10141519-10141541 ATGAATACAGAGAAGAATCAAGG + Intronic
1135063643 16:19291286-19291308 ATGGATAAAGGAATTAATGAAGG + Intronic
1135245443 16:20852759-20852781 TTGGATCCAGAGATCAGTCAGGG - Intronic
1138800996 16:60029737-60029759 ATGGATAAGGAAAACAATGATGG - Intergenic
1143054498 17:4152712-4152734 ATGAATAAAGAAAGGAATCAGGG - Intronic
1144446751 17:15337987-15338009 AAGGATAAAGGGATCAGTCAAGG + Intronic
1146641637 17:34546373-34546395 ATTTCTAAAGAGATCAACCATGG + Intergenic
1147481964 17:40774209-40774231 ATGGATAAAATAATCAATCCCGG - Intergenic
1147503471 17:40989154-40989176 ATTGATGAAGAGATAAATGAAGG + Intergenic
1147527133 17:41236299-41236321 ATGAATAAAAACAGCAATCACGG - Intronic
1149277291 17:55055988-55056010 ATGGATAAAGGGATAAATGGAGG + Intronic
1151057824 17:71053990-71054012 AGGGACACAGAGATCAAACAGGG + Intergenic
1152333294 17:79685832-79685854 ATGGATGACCAGATCATTCACGG - Intergenic
1153595744 18:6723401-6723423 ATGGAAAAAGAGAGAAATTAAGG + Intergenic
1154355039 18:13618611-13618633 ATGGATATAGAGGAAAATCATGG - Intronic
1155601786 18:27557318-27557340 ATGGATAAAGGGATCAAAAGAGG + Intergenic
1156884564 18:42119623-42119645 ATGGATTAAAAGAGAAATCAAGG - Intergenic
1157565211 18:48675107-48675129 ATGGATTCAGGGTTCAATCATGG + Intronic
1158918664 18:62164800-62164822 GTGGGTAAAGAAATGAATCAAGG + Intronic
1159271386 18:66156121-66156143 ATGTACAGAGAAATCAATCACGG - Intergenic
1159518270 18:69486196-69486218 ATGTTTAAAGATATCAATAAAGG - Intronic
1160502568 18:79409552-79409574 AGGGATAAAGAGATGGATTATGG - Intronic
1162128913 19:8513590-8513612 ATGCATAAGGAGCTCAATCCGGG - Intronic
1165180603 19:33964121-33964143 ATGGATAAAGATGTCCAACAAGG + Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
925421152 2:3713013-3713035 ATGAATAAAGAGTTCAAGAAAGG + Intronic
925745358 2:7039144-7039166 ATGGATAGAGAGATGGATGATGG + Intronic
925745392 2:7039334-7039356 ATGGATAGAGAGATGTATGATGG + Intronic
925745409 2:7039431-7039453 ATGGATAGAGAGATATATGATGG + Intronic
926504217 2:13691087-13691109 ATTGATAAATAAATAAATCATGG - Intergenic
928121840 2:28589373-28589395 TTGGAGAAAGAGATCAATCAAGG + Intronic
929094162 2:38247890-38247912 ATTGATGAAGAAATCAATAAGGG - Intergenic
929926695 2:46218197-46218219 ATGGATAAATGGATGAATAATGG - Intergenic
930790720 2:55325132-55325154 TTGAATCAAGAGATCAATCTGGG + Intronic
933386394 2:81616675-81616697 ATGAATAAAAAGATCATTAAAGG - Intergenic
933457735 2:82538262-82538284 ACAGATAAGGAGATAAATCAGGG - Intergenic
934584057 2:95473883-95473905 ATTGAAAAGGAGATCAAGCAAGG - Intergenic
934595395 2:95602831-95602853 ATTGAAAAGGAGATCAAGCAAGG + Intergenic
934787376 2:97022660-97022682 ATTGAAAAGGAGATCAAGCAAGG - Intergenic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
935517046 2:104052757-104052779 ATGGAAAAAGAGATAAAGCTTGG + Intergenic
935724857 2:106014835-106014857 ATTGGAAAAGAGATCACTCATGG - Intergenic
935858699 2:107303522-107303544 ATGAATAAATTTATCAATCAAGG - Intergenic
936393920 2:112103890-112103912 AAGGATAGAGAAATCCATCAAGG + Intronic
937383971 2:121408859-121408881 ATGAATAAAGACAACAATGATGG + Intronic
937824682 2:126355431-126355453 GTGGCTAAATATATCAATCAGGG - Intergenic
938950473 2:136250184-136250206 ATTGATCAAGAGATCAAGAAAGG + Intergenic
943550518 2:189332966-189332988 ATGGATCAAAAGAGAAATCACGG + Intergenic
945475462 2:210276893-210276915 GAGTATGAAGAGATCAATCACGG + Intergenic
945701817 2:213179808-213179830 CTGGTTAAAGAGATTAGTCAAGG + Intergenic
946503074 2:220270404-220270426 ATTTTTAAAGAGATTAATCATGG - Intergenic
946590169 2:221237742-221237764 ATGGTTAAAGAGATCATGGAGGG - Intergenic
947289846 2:228560808-228560830 TTGGATAAATACATCATTCAAGG - Intergenic
1168904971 20:1395795-1395817 ATGGAGAATGAGAGCAACCAGGG + Intergenic
1169438583 20:5614898-5614920 ATGGTTAATGAGATCAATTTAGG + Intergenic
1171227117 20:23451190-23451212 ATGGATGAAGAAATGAAGCAAGG - Intronic
1172334010 20:34098999-34099021 AAGAATAAAGAGATGAATGAGGG - Intronic
1175883761 20:62276215-62276237 ATTGATAAAAATCTCAATCATGG - Intronic
1176304230 21:5114915-5114937 ATGCATAAAGTGATCAAGGAAGG - Intergenic
1177562802 21:22778505-22778527 ATGGATAAATAGATCAGTTTGGG + Intergenic
1178096217 21:29218614-29218636 ATGCATCAAGAGATAAGTCATGG - Intronic
1179852826 21:44147115-44147137 ATGCATAAAGTGATCAAGGAAGG + Intergenic
1181958982 22:26609478-26609500 ATGGATAAAGGGATGGATGAAGG + Intronic
950526853 3:13529292-13529314 ATGGAGAAAGAGATGAATAGAGG - Intergenic
951296409 3:20941352-20941374 ATGGAAATAAAGATCAATTATGG + Intergenic
951366520 3:21789709-21789731 ATGTAAAAAAAGATAAATCAAGG + Intronic
951397845 3:22192040-22192062 ATGGAGAAAGAGATGAATGATGG - Intronic
952203762 3:31158374-31158396 ATGGAGAAAGTCATTAATCAAGG - Intergenic
952587639 3:34912005-34912027 ATGCAGAAAGACATCCATCAAGG - Intergenic
952983899 3:38760555-38760577 ATGTATAAATAAATAAATCATGG - Intronic
953006810 3:38986547-38986569 ATGTAAAAAGAAATCAATCCAGG + Intergenic
955200284 3:56845821-56845843 ATGAATAAAGAAATGAATAAAGG + Intronic
956061392 3:65351687-65351709 ATGCATAAAGACATCACTTAGGG + Intergenic
957850037 3:85796198-85796220 ATGCATAAATTGAGCAATCAGGG - Intronic
958663343 3:97101961-97101983 TTGGATAAAGAGTTCTAGCAGGG - Intronic
959299997 3:104586702-104586724 ATGGAAAATGACATAAATCAAGG + Intergenic
961184249 3:124901035-124901057 AGGAATAAAGAGACCAACCAAGG + Intronic
965294054 3:166920434-166920456 CTGTCTAAAGACATCAATCATGG - Intergenic
965384436 3:168029258-168029280 ATGGATAATGATATCGTTCAGGG - Exonic
965393666 3:168135288-168135310 ATGGTTAAAGATAGCAGTCAAGG + Intergenic
966163849 3:176995039-176995061 ATGGAAGAAAAGATGAATCATGG - Intergenic
969674099 4:8605552-8605574 ATGGATAGATATATCAATGATGG - Intronic
970311004 4:14782481-14782503 ATGGATAAACAGATGAATATAGG + Intergenic
971988003 4:33851509-33851531 ATGAATAAATAGAAGAATCAAGG + Intergenic
972819837 4:42688016-42688038 ATGAATAAATATATAAATCATGG + Intergenic
975947438 4:79724380-79724402 ATATATAAAGAGATAATTCACGG + Intergenic
977103260 4:92845932-92845954 GTGGAAAAATAGATCAAACAGGG - Intronic
977800348 4:101222417-101222439 ATGGCTAAAAAGAACAATTATGG - Intronic
979861027 4:125693969-125693991 ATGGCTAAAGAAAACAATCATGG - Intergenic
980373491 4:131911188-131911210 ATGCATAAAGAGTGCAACCATGG + Intergenic
980929546 4:139172414-139172436 GTGGATAAAGGGATGATTCATGG - Intronic
981369000 4:143936761-143936783 AAGGATAAAGAGATGAATATGGG + Intergenic
981659046 4:147145023-147145045 ATGGCTCAAGGGATAAATCATGG + Intergenic
981978229 4:150758553-150758575 AAAGACAAAGAGATCAATTAGGG - Intronic
982585979 4:157240215-157240237 ATGGAAAAAGCTATCAATGAGGG - Intronic
982661380 4:158210661-158210683 ATGGTTAAAAAGAAAAATCAAGG + Intronic
982865900 4:160511475-160511497 AAGGATGAAGACATCAATTATGG + Intergenic
984136555 4:175947943-175947965 ATGAATAAAAAGATGAATGAAGG + Intronic
987553721 5:19417605-19417627 ATGTATAAAGAGATCACTCATGG - Intergenic
988166329 5:27594956-27594978 ATGGAAAAAGAGATTAGTCTGGG + Intergenic
988812897 5:34802756-34802778 AAGGATAAAGAAATAAAGCAGGG + Intronic
988942280 5:36158619-36158641 ATGGAAACAGAAATCAATCAGGG - Intronic
989972570 5:50542320-50542342 ATGGATAAATAGAATAACCAAGG + Intergenic
990095393 5:52105444-52105466 TTGGATAAATAGAACAAACACGG + Intergenic
991152299 5:63384681-63384703 GTGGCAAAAGTGATCAATCATGG - Intergenic
991563046 5:67974613-67974635 ATGGAAAAAGCAATTAATCATGG + Intergenic
992370678 5:76140806-76140828 GAGGACAAAGAGATCAAGCAGGG - Intronic
993648474 5:90488671-90488693 ATGTATAATGATAACAATCACGG - Intronic
994635096 5:102335648-102335670 ATAGATAAATAGATAAATAAAGG + Intergenic
995414933 5:111899265-111899287 AAGGATATACAGAACAATCAAGG + Intronic
996220320 5:120924198-120924220 ATGGAGTAAAAGCTCAATCAAGG - Intergenic
996414455 5:123195160-123195182 TTAGATAAAGAGAGAAATCAGGG + Intergenic
996506371 5:124271993-124272015 AAGGATAAAGAGTTCAATAAAGG - Intergenic
996683108 5:126249859-126249881 ATGGATAAAGAGATCACCTTGGG - Intergenic
996980521 5:129487250-129487272 ATGGATAAAAATTTCAGTCAGGG + Intronic
997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG + Intronic
999410435 5:151345530-151345552 AGGGTTAAAGAGAACAATCGAGG + Intronic
1002008651 5:176258181-176258203 AGGGTTAAACATATCAATCATGG + Intronic
1002218070 5:177654070-177654092 AGGGTTAAACATATCAATCATGG - Intergenic
1004404823 6:15323225-15323247 ATGGATAGAGAAGGCAATCAGGG - Intronic
1007283887 6:40733616-40733638 ATGGATTAATAGATGAATAAGGG + Intergenic
1008353362 6:50520084-50520106 CTATATAAAGAGATCACTCAGGG + Intergenic
1008416270 6:51244424-51244446 ATGGAGAAAAAGAGCAATGAAGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008549749 6:52616913-52616935 CTGGATAAAGAAATAAATTAAGG + Intergenic
1009494243 6:64328947-64328969 AAGGATAAAGGCAACAATCAGGG + Intronic
1010262470 6:73832211-73832233 ATGGAGAAAGAGATAAAGTAGGG - Intergenic
1010497711 6:76555500-76555522 ATGGATAAAGAGAAAATTCTTGG + Intergenic
1011087472 6:83558597-83558619 ATGGATTTAGAGATGCATCAAGG + Intronic
1012269025 6:97184583-97184605 ATAGATAAAGAGAGGAATTAAGG - Intronic
1015123374 6:129725414-129725436 AAGGATAAACAGATGAATCCAGG - Intergenic
1015591597 6:134827967-134827989 AAGAATAAAGAGATGAATCCCGG + Intergenic
1016379067 6:143454985-143455007 ATGGATAAAAAAATCACTTAGGG + Intronic
1020882268 7:13777094-13777116 GTGGATGAAGAGATCAATCAGGG + Intergenic
1021168686 7:17371719-17371741 TTGCATAAAGAAATCAAGCAAGG - Intergenic
1022508799 7:30922462-30922484 AGGGAGAAAGAGAACAATCAGGG - Intronic
1022580208 7:31545424-31545446 TTGGATAAAGAGGGAAATCATGG + Intronic
1023150201 7:37194910-37194932 ATGAATGAATAGATCAATTAAGG - Intronic
1023766889 7:43520250-43520272 ATGGAAAAAGAGATAAAGAAGGG - Intronic
1025706445 7:63869432-63869454 ATGTATAAAGTGAACAATTAGGG - Intergenic
1026349472 7:69503181-69503203 ATGGATAAAAGGATTATTCATGG + Intergenic
1027112883 7:75454768-75454790 ATGGATAAAGAGATGGCACACGG + Intronic
1027285129 7:76639379-76639401 ATGGATAAAGAGATGGCACACGG + Intergenic
1028457274 7:91052054-91052076 ATGGATGAAGAGTTCTGTCAAGG + Intronic
1028770449 7:94614482-94614504 ATGGAGAAAGAGATCCAGAAGGG - Intronic
1030738432 7:113079301-113079323 CTGGCTAAAGACATTAATCAAGG - Intronic
1031704646 7:124964733-124964755 GTGGCTAAAGAGAGAAATCAAGG - Intergenic
1032736217 7:134694893-134694915 ATGTATAAAGTGCTCAAGCAGGG - Intergenic
1035147232 7:156831470-156831492 AAAGACAAAGAGATCAATAAGGG + Intronic
1035882756 8:3260203-3260225 ATGCATAAAGAGTTCAATTCAGG - Intronic
1037049509 8:14352898-14352920 ATGTATGCAGAGATCAATTAGGG - Intronic
1037108260 8:15136663-15136685 ATGGAGAATGAGAGCAAGCAGGG - Intronic
1039304090 8:36242126-36242148 AGGGATGAAGAGTTTAATCAGGG + Intergenic
1041345018 8:56888363-56888385 ATGGAGAAAGAGGTCCATGAAGG - Intergenic
1044688352 8:94850820-94850842 ATGGAAAAAAAAATCAAACAAGG - Intronic
1044789973 8:95837302-95837324 ATGAATGAATAGATGAATCAAGG - Intergenic
1044953460 8:97455802-97455824 ATGGATAAATAGATGAATAAAGG - Intergenic
1046179202 8:110620901-110620923 ATGGAGAAAGAGTGCATTCATGG - Intergenic
1047643314 8:126843945-126843967 AGGGAAAAAGAGATAAAACATGG + Intergenic
1047845682 8:128802478-128802500 ATGGATAACTAGAATAATCAAGG + Intergenic
1047852221 8:128869537-128869559 ATGGATCAAGAAATAAAGCAAGG - Intergenic
1048705095 8:137145254-137145276 AATGATAAAAAGAACAATCAAGG + Intergenic
1049489416 8:142886841-142886863 ATTTATAAAGAGTACAATCATGG + Intronic
1050136567 9:2472047-2472069 ATGAAGAAAGAGAATAATCAGGG - Intergenic
1051114344 9:13676746-13676768 ATGGAGTAAGATATTAATCATGG - Intergenic
1051838021 9:21362635-21362657 ATGGCTATAGAGATTTATCAGGG + Intergenic
1052000601 9:23274858-23274880 ATGGATATAGAGCTAAATCAGGG + Intergenic
1052568948 9:30196622-30196644 ATGGATGAAGAAATCATTGAAGG + Intergenic
1053089842 9:35265115-35265137 GTGGATAAAGACATGAATTATGG + Intronic
1054943414 9:70768904-70768926 TTGGAAAAAGAGATCATGCATGG + Intronic
1056085475 9:83144774-83144796 ATGGAAGAAGAGATAAACCAGGG + Intergenic
1057322533 9:94028274-94028296 TTGGATAGAGAGCACAATCAAGG - Intergenic
1057417968 9:94882238-94882260 ATGGGTAAAGAGAGGAAACAGGG + Intronic
1057633950 9:96745654-96745676 ATGGAAAAAGAGACAAATGAAGG - Intergenic
1185883876 X:3764536-3764558 ATGGATAGATAAATGAATCATGG - Intergenic
1186309898 X:8306531-8306553 CTGGATGAAGAGATTAATCTTGG - Intergenic
1186937508 X:14466669-14466691 ATGGAAAAAGAAATCAATAATGG + Intergenic
1187060101 X:15778495-15778517 ATGGATAAAGAGATCAATCAAGG + Intronic
1188072024 X:25728661-25728683 ATGGAGAAAGAGATACTTCAGGG + Intergenic
1188396749 X:29694392-29694414 ATGCATATAGATATCAATCAGGG + Intronic
1188998042 X:36910243-36910265 AAGGATAAAGAAAACAATAATGG - Intergenic
1189095117 X:38130346-38130368 ATGGACAGATAGATCAATAATGG - Intronic
1189122137 X:38406270-38406292 ATGGGGAAATAGATTAATCATGG - Intronic
1189733687 X:44048209-44048231 AAGGAGAAAGAGATGAATTAAGG - Intergenic
1191641517 X:63433004-63433026 AAAGATAAAGAAATCACTCAAGG - Intergenic
1191982230 X:66938975-66938997 ATGGATAAAGAAGACAAACATGG + Intergenic
1192397874 X:70801563-70801585 AAGGAAAAAGAGAGCATTCATGG - Intronic
1193170468 X:78329843-78329865 AAAGATAAAGAGATGAAGCAAGG - Intergenic
1193633675 X:83922190-83922212 ATGGACACAAAGATCATTCATGG + Intergenic
1194812559 X:98403891-98403913 ATGGTTAAAGAGACTAAGCAAGG - Intergenic
1196279020 X:113800872-113800894 ATTGCTAAAGAGATCTGTCATGG - Intergenic
1196315491 X:114217524-114217546 ATGAATAAAAAGATCACTGACGG - Intergenic
1196764575 X:119231161-119231183 ATGGAGCTAGAGCTCAATCAAGG + Intergenic
1197412272 X:126133243-126133265 ATAGATAAAGAGGTAAATTAAGG - Intergenic
1199882853 X:151988752-151988774 ATGGAAAAAGAAATATATCAAGG - Intergenic
1200781544 Y:7220755-7220777 ATGGATAGATAAATGAATCATGG + Intergenic