ID: 1187062306

View in Genome Browser
Species Human (GRCh38)
Location X:15798863-15798885
Sequence ACTCCCGGTGATGCTAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187062304_1187062306 -2 Left 1187062304 X:15798842-15798864 CCTTTCACATCAGGTTGTTGCAC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1187062306 X:15798863-15798885 ACTCCCGGTGATGCTAACTGTGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187062306 Original CRISPR ACTCCCGGTGATGCTAACTG TGG Intronic
901315223 1:8302579-8302601 ACTCCCGGCGTTACTCACTGTGG - Intergenic
904407666 1:30303832-30303854 ACTCCCCATGATGCAACCTGTGG + Intergenic
906326394 1:44848744-44848766 TCTCCCAGTGATGCTCAATGAGG - Intergenic
910802053 1:91156932-91156954 ACCCCAGGTGATGCTAATTCTGG + Intergenic
924457265 1:244228732-244228754 AGTCCCGGTGACCCTCACTGCGG - Intergenic
1087242799 11:95798603-95798625 AACCCAGGAGATGCTAACTGTGG - Intronic
1098018392 12:66130464-66130486 ACTCCCGCTGAAGTTAACTTCGG - Intronic
1102772361 12:115489329-115489351 GCACCCTGTCATGCTAACTGAGG - Intergenic
1102805471 12:115776001-115776023 ATTACTGGTGATGCTAACTTTGG + Intergenic
1104129380 12:125878333-125878355 CCTCCCAGTGATGCTCAGTGGGG - Intergenic
1108478898 13:50847081-50847103 ACTTCCTGTGCTGCTAAATGTGG - Intergenic
1120780279 14:88480159-88480181 ACTCCCGGTGATGCTAGGGTTGG + Exonic
1123450099 15:20354351-20354373 CCACCCTGTGATGCTAAGTGTGG + Intergenic
1124902418 15:33836727-33836749 TCTCCCGGTGCTGCAAACAGTGG + Intronic
1127299710 15:57640973-57640995 GCTCACTGAGATGCTAACTGTGG - Intronic
1136994348 16:35178098-35178120 CCTCACAGTGATGCTTACTGAGG - Intergenic
1156452789 18:37275890-37275912 ATTCCCTGGGATGCTCACTGGGG + Intronic
1157949262 18:52016346-52016368 ATTCCAGGTGATGCTAAATGTGG + Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
925807107 2:7661285-7661307 ACTCCATGTGATGCTCATTGTGG - Intergenic
941748418 2:169111025-169111047 AATCCCGGGGAAGCTTACTGCGG + Intergenic
945922093 2:215765055-215765077 ACTCTATGTGATGCCAACTGGGG + Intergenic
1168862875 20:1058622-1058644 CTTCCAGGTGATGCTCACTGGGG + Intergenic
1175523921 20:59620642-59620664 AATCCTGGTGATGTTGACTGTGG + Intronic
1177209702 21:18055600-18055622 CCTGCCGGATATGCTAACTGTGG - Intronic
1182404686 22:30115949-30115971 AATGCCTGTGATGTTAACTGTGG - Intronic
1184661245 22:45966519-45966541 ACTCCAGGGGATGCTCACTCGGG + Intronic
952309876 3:32178758-32178780 ACACCAGGTGATGCCAAATGTGG - Intergenic
964628704 3:158784924-158784946 TCTCCAGGTGAGGCAAACTGTGG - Intronic
969054848 4:4395233-4395255 ACTTCAGGTGATGCTGACTCAGG - Intronic
972679790 4:41294317-41294339 ACTCCCAGAGATGCTAATTCTGG + Intergenic
982933057 4:161433439-161433461 ACTCAGTGTGATGCTAGCTGTGG - Intronic
984740536 4:183157367-183157389 ATTCCCCGTGATACTAACTTTGG + Intronic
986514796 5:8550025-8550047 AGTCCCGGTGAGTCTCACTGAGG + Intergenic
986722014 5:10566213-10566235 GCTCCAGGTGATGCTACCTACGG - Intronic
989090801 5:37728656-37728678 ATTACTGGTGATGCTAACTTTGG + Intronic
998404232 5:141864724-141864746 ACTGCCAGTGATGCTGACTCTGG - Exonic
1010180186 6:73077276-73077298 ATTCCTGGTCGTGCTAACTGTGG + Intronic
1011139573 6:84137854-84137876 TCTTCCGTTGATGCTAACTCAGG - Intronic
1028134003 7:87207759-87207781 ACTCCCTGCGATGCTGTCTGAGG - Intronic
1029324361 7:99793258-99793280 AAGCCCGGTGATGTTATCTGGGG - Intergenic
1029381551 7:100218663-100218685 ACTCCAGGTGACACTGACTGGGG + Intronic
1029400987 7:100345990-100346012 ACTCCAGGTGACACTGACTGGGG + Intronic
1034874103 7:154709973-154709995 AGTCCAGGTGATGCTGAATGTGG - Intronic
1036759199 8:11495474-11495496 ATTCCCGGTGATGCTAAGCTTGG - Intronic
1038341592 8:26690902-26690924 AATCACGGGGAGGCTAACTGTGG - Intergenic
1041783132 8:61600259-61600281 ACTCACTGTGATGTTAGCTGTGG - Intronic
1042666753 8:71215598-71215620 ACTCCCGGTGAGGCTCTCTGCGG - Exonic
1046505002 8:115125714-115125736 ACTCTCAGTGATGACAACTGAGG + Intergenic
1050689611 9:8210627-8210649 CTTCCAGGTGATGGTAACTGAGG - Intergenic
1062236097 9:135508475-135508497 ACTCCCTGTGAGGCTGAGTGGGG - Intergenic
1187062306 X:15798863-15798885 ACTCCCGGTGATGCTAACTGTGG + Intronic
1192263094 X:69520342-69520364 CCTCCCTCTGATGCTGACTGTGG - Intronic
1199248493 X:145632835-145632857 ACTCAATGTGATGCTAGCTGTGG - Intergenic
1200161844 X:154013586-154013608 ACTCCCTGTGATGGGAACAGAGG - Intronic
1201364321 Y:13186722-13186744 TCTCCCAGTGAGGCTACCTGGGG - Intergenic