ID: 1187064313

View in Genome Browser
Species Human (GRCh38)
Location X:15818387-15818409
Sequence GACCTGGACCAACAGGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187064313 Original CRISPR GACCTGGACCAACAGGGATC AGG Intronic
900764310 1:4493864-4493886 GCCCTGGACCCACAGTGCTCAGG + Intergenic
903560827 1:24225633-24225655 GATCTTGACCTAGAGGGATCGGG + Intergenic
903974704 1:27141838-27141860 GGCCAGGACCCACAGGAATCTGG - Intronic
907300264 1:53482578-53482600 GAGGTGGACCAACAAGGACCTGG - Intergenic
910858029 1:91715798-91715820 GGCATGGACCCACAGGGATTTGG + Intronic
917845965 1:179020383-179020405 CATCTGGACCAACAGGGCACTGG + Intergenic
923908029 1:238407727-238407749 GACAAGGACAAACAGGGCTCTGG + Intergenic
1062859928 10:803255-803277 GACCTGGAGAGACAGGGCTCGGG - Intergenic
1065788075 10:29234798-29234820 GACCTGAATGAACAGGGAACTGG - Intergenic
1067112113 10:43408373-43408395 GAACTGGACCCACTGGGATCGGG - Intronic
1070362514 10:75704745-75704767 GACCTGGACCCACCTGGCTCGGG - Intronic
1073096050 10:100980363-100980385 GATCAGGGCCAACAGGGATCAGG - Intronic
1075854811 10:125620500-125620522 GACCATGGCAAACAGGGATCAGG + Intronic
1077054884 11:586664-586686 CACCTTGACCAGCAGGGAGCAGG - Intronic
1077185541 11:1233940-1233962 GACCTGGCCCGGCAGGGTTCAGG - Intronic
1081285873 11:41269539-41269561 GCCCTGGACCACCAGGGAGAAGG + Intronic
1082881641 11:58043890-58043912 GTCCTGGACCCACAGAGCTCAGG - Intronic
1089872463 11:121688052-121688074 GACCTAGACCTCCAGGGCTCAGG + Intergenic
1090915036 11:131155700-131155722 CACCTGAAGCAACAGGGATGGGG + Intergenic
1102776380 12:115523170-115523192 GACCTTGACCACCTGGGCTCTGG - Intergenic
1103195417 12:119039549-119039571 GTCCTACACCAGCAGGGATCAGG - Intronic
1105341432 13:19529644-19529666 AACCTTCACCAAGAGGGATCAGG - Intronic
1110182897 13:72638387-72638409 GACCAGGACCAAAAGAAATCAGG + Intergenic
1111106138 13:83647986-83648008 AACCTGGAACAGCAGAGATCAGG - Intergenic
1113063928 13:106355260-106355282 GACCTGGAACTACAGGGAGCTGG - Intergenic
1119148275 14:72335327-72335349 ACCCTGGACAAACAGGGATGGGG - Intronic
1121106218 14:91281606-91281628 GAGCTGGAGCTACTGGGATCCGG - Intronic
1121340160 14:93100225-93100247 GACCTGGAGCATGAGGGATGGGG + Intronic
1127000158 15:54493829-54493851 GACCTGGACATACAGGGCTGGGG - Intronic
1129974528 15:79811243-79811265 GACCTGAACCAACATGGAATGGG - Intergenic
1131508574 15:93036487-93036509 GGCCGGGACCACCAGGGACCAGG - Intronic
1134715844 16:16357740-16357762 GGCCTGAACCAACACGGTTCTGG - Intergenic
1135606968 16:23833930-23833952 GACCCTGACCTACAGGAATCTGG + Intergenic
1136014231 16:27384829-27384851 GAACTGGGCCATCAGGAATCAGG - Intergenic
1141797730 16:86286390-86286412 GCCCTGGACCACCAGGGCGCAGG - Intergenic
1143359608 17:6358297-6358319 GGCCTGGACCACCAGGCTTCTGG - Intergenic
1144713801 17:17420630-17420652 CACAAGAACCAACAGGGATCTGG - Intergenic
1145991742 17:29083177-29083199 GACCTTGAGCGACAGGGCTCTGG - Intronic
1148864108 17:50619702-50619724 GCCCTGGATCAGCAGGGATATGG - Exonic
1149437381 17:56644642-56644664 GACCTGGAAGAAGGGGGATCTGG + Intergenic
1149550630 17:57536942-57536964 GACATTGACCAACAGGAATCTGG + Intronic
1151563063 17:74881092-74881114 GGGGTGGGCCAACAGGGATCTGG + Exonic
1152855478 17:82663000-82663022 GTCCTGGACCTGCAGGGCTCAGG + Intronic
1156312498 18:35937651-35937673 GAGCTGGACTACCTGGGATCAGG - Intergenic
1157997830 18:52580664-52580686 GACCTGGACCAACACTGAGTTGG + Intronic
1160995187 19:1879187-1879209 GACCTGCTCCCACAGGGACCAGG - Intronic
1162145893 19:8611793-8611815 GACCAAGACCAAGAGGGCTCCGG - Intergenic
1162322099 19:9976585-9976607 CACCTGGACAACCAGGGATACGG - Exonic
1165622801 19:37262564-37262586 GCCAGGGAGCAACAGGGATCAGG - Intergenic
1166544428 19:43625721-43625743 GACCTGGACGAATAGGGATCTGG - Intronic
1166544459 19:43625843-43625865 GACCTGGAAGAACAGGGACCAGG - Intronic
926160127 2:10481990-10482012 GAGCTGGGCCAACTGGGTTCAGG - Intergenic
927153612 2:20209563-20209585 GACCTGTGCCACCAGGGATGGGG + Intronic
927523648 2:23718513-23718535 GACCAGGACCAAGAGGGAAAAGG + Intergenic
933993189 2:87648448-87648470 TGCCAGGACCAACAGGGCTCTGG + Intergenic
936061623 2:109298676-109298698 GACCTGGACCCACAGGAGCCAGG - Intronic
936300668 2:111302435-111302457 TGCCAGGACCAACAGGGCTCTGG - Intergenic
936604708 2:113938767-113938789 GAGTTGAACCAACAGGGAGCTGG - Intronic
938953452 2:136278202-136278224 GACCTAGACCTCCAGGCATCTGG + Intergenic
941625306 2:167824701-167824723 GACCTGTCCCAAGAGAGATCAGG - Intergenic
943553569 2:189372076-189372098 GAGCTGGAGCAACTGGGATGTGG - Intergenic
947377323 2:229510005-229510027 GGCCTGAAACAACAGAGATCTGG + Intronic
1168799144 20:633481-633503 GGCCTGGCCCAGCAGGGAGCTGG - Intergenic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1169121496 20:3099195-3099217 TACCTGGGACTACAGGGATCTGG - Intergenic
1169227704 20:3866462-3866484 CACCTGGGCCAACAGGGCTGAGG - Exonic
1170719062 20:18859489-18859511 GAGCTGGAGCAGCAGGGATAAGG - Intergenic
1172227467 20:33314724-33314746 GTCCTGGACCAACAGGCTTTAGG - Intergenic
1180037407 21:45256841-45256863 GACCTGGAGCCACAAGGACCTGG - Intergenic
1182062255 22:27406710-27406732 GACCTAGGCCTCCAGGGATCAGG + Intergenic
949602896 3:5620308-5620330 GAGCGGGAACAACAGGGAGCTGG - Intergenic
956314564 3:67919937-67919959 GATCTGGACCTACAAGGCTCTGG + Intergenic
956530905 3:70217462-70217484 GACTTGTACCAAGAGGGATTGGG + Intergenic
958579987 3:96006678-96006700 GGCCTGGACCAACTAGGATCTGG + Intergenic
959904428 3:111694732-111694754 GAGCTGGACCCTAAGGGATCCGG + Intronic
961096054 3:124157893-124157915 CACCTGGAGCAACAGGACTCAGG - Intronic
969117485 4:4880365-4880387 GACTTGGACCAACAAAGATGGGG - Intergenic
974638000 4:64590399-64590421 GAGCTGGACAAACTGGGATGTGG - Intergenic
975213014 4:71722798-71722820 GAGCTAGACCACCAGGGACCTGG - Intergenic
978202480 4:106038344-106038366 GACCTGGACCAACAAGTATCTGG + Intergenic
983060988 4:163160727-163160749 GTGCTGGACCTTCAGGGATCTGG - Intronic
994321686 5:98401895-98401917 GGCCTGGACAAACAGGAATGTGG - Intergenic
995314326 5:110750796-110750818 GACCTGAACCAATAGTGTTCTGG - Intronic
997826334 5:137110088-137110110 GACCTGGAGCAAAAGGGGGCAGG + Intronic
998762352 5:145446625-145446647 GACATAGACCAACAGGGAAAGGG + Intergenic
1000281503 5:159786390-159786412 GACCTGGAGGAAAAGAGATCTGG - Intergenic
1003880896 6:10478683-10478705 GATATGGACCCACAGGGGTCAGG - Intergenic
1004262570 6:14120994-14121016 GAGCTGGGCCAACAGGAATTGGG - Intronic
1004986456 6:21088240-21088262 GATCTGGGTCAACAGAGATCTGG + Intronic
1006588958 6:35140734-35140756 GAGCTGGACCTACAGGGAGGGGG + Exonic
1007407182 6:41641847-41641869 GTCCTGGACCAACAGGGAGTAGG - Intronic
1018675989 6:166222819-166222841 GACCTTGCCCAACAGGAAACGGG + Intergenic
1022651769 7:32283964-32283986 TACCTTGATCAACAGGGACCAGG + Intronic
1023076129 7:36484106-36484128 GAACTGGACCAAGATGGAACTGG - Intergenic
1024518882 7:50285275-50285297 CTCCTGGACCAACACGGACCTGG + Intergenic
1036038152 8:5042848-5042870 GTCCTGGACCAAAAAGGATGGGG - Intergenic
1056021255 9:82440674-82440696 GAGCTGGAGCAGCAGGGATATGG - Intergenic
1057209688 9:93193030-93193052 GACCTGGCCCAGCAGGGGTTTGG + Intronic
1058869485 9:109190159-109190181 GTGCTGGACCAACAGGGAACTGG - Intronic
1187064313 X:15818387-15818409 GACCTGGACCAACAGGGATCAGG + Intronic
1187288825 X:17932349-17932371 GAGCTGGACCTTCAGGAATCGGG - Intergenic
1191788819 X:64946227-64946249 GACCTGTACCACCAGGGCCCTGG - Intronic
1195687511 X:107600283-107600305 GACCTGGAGGAACAGGGATAGGG - Exonic
1197445880 X:126552157-126552179 GCCCAGGACCAACAGGGCTGCGG - Exonic
1197742579 X:129906439-129906461 CATCAGGACCAACAGGGATGCGG - Intronic