ID: 1187065506

View in Genome Browser
Species Human (GRCh38)
Location X:15833338-15833360
Sequence AAGCAGTAAAAGGTGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187065506_1187065511 -7 Left 1187065506 X:15833338-15833360 CCCTGACACACCTTTTACTGCTT 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1187065511 X:15833354-15833376 ACTGCTTTTAGGAAAGAAAAGGG 0: 1
1: 0
2: 3
3: 85
4: 599
1187065506_1187065510 -8 Left 1187065506 X:15833338-15833360 CCCTGACACACCTTTTACTGCTT 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1187065510 X:15833353-15833375 TACTGCTTTTAGGAAAGAAAAGG 0: 1
1: 0
2: 2
3: 58
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187065506 Original CRISPR AAGCAGTAAAAGGTGTGTCA GGG (reversed) Intronic
901373866 1:8823474-8823496 AAGCACTAAAATGAGTGTCCAGG - Intergenic
901948771 1:12724900-12724922 AAGCAGGAGCAGGTGAGTCAGGG + Intronic
906087569 1:43148879-43148901 AAGCAGGAACAAGTGGGTCAGGG - Intronic
907468079 1:54652803-54652825 AAGCCTTAACAGGTGTGGCATGG + Intronic
909045894 1:70709388-70709410 AAGCACAAAAACTTGTGTCATGG + Intergenic
910223290 1:84911574-84911596 TAGTACTAAAAGGTGTGTGAAGG - Intergenic
910595983 1:88981392-88981414 AAGCTGTAAAATCTGTGTAAAGG + Exonic
913533514 1:119749775-119749797 AAGAAGAAAAAGGTGTGCCGAGG - Intronic
914433399 1:147639909-147639931 AAGCAGTAAAGGGAGTGTGCCGG - Intronic
916218500 1:162419840-162419862 AAGCTTTAAAAGGTGAGTCCAGG - Intergenic
918469066 1:184851736-184851758 AAGAAATAAAAGGTGAGTTATGG + Intronic
920690976 1:208146065-208146087 AAGGAGAAAAAGGTGGGGCAGGG + Intronic
921521883 1:216166406-216166428 AAGCAGAAAAGGGTTTGTGAAGG + Intronic
922363952 1:224846415-224846437 AAGCAGTACCAGATGTGTCAGGG + Intergenic
922993854 1:229940423-229940445 AAGGAGGAAAAGGTATATCAAGG - Intergenic
923512431 1:234664062-234664084 AAGCAGATAAAGGTGTTTCCTGG + Intergenic
924746994 1:246845026-246845048 AAGCAGAACAATGTGTGGCAGGG + Intronic
1063704579 10:8418558-8418580 AAATAGTAGAAGGTTTGTCAGGG - Intergenic
1065010036 10:21412486-21412508 AAGAATCAAAGGGTGTGTCAGGG + Intergenic
1065806266 10:29395863-29395885 AAGCAGGAAAAGTACTGTCATGG - Intergenic
1067399001 10:45953681-45953703 AAACAGTAAAAGCTGAGGCAAGG - Intergenic
1071117758 10:82243116-82243138 ATGCAGTAAAAGTTGTATGAAGG - Intronic
1074467588 10:113697191-113697213 AAACAGTGGAAGGTCTGTCAAGG - Intronic
1076405698 10:130211270-130211292 AAGCAGTCAAAGGTGAGTAGAGG - Intergenic
1077796571 11:5498681-5498703 AAGAAGTAAAGGGTGTATCTTGG - Intronic
1079154006 11:17927149-17927171 CAGGAGCAAAAGGTGTGTCTGGG - Intronic
1079395782 11:20062166-20062188 AACCAGGAAAGGTTGTGTCAAGG + Intronic
1084045691 11:66566591-66566613 AAGCAGTAAATGGGGTCTAAAGG + Intronic
1085525393 11:77160799-77160821 AAGCAGGAAAAGGGGTCTCCAGG + Intronic
1085693840 11:78687332-78687354 AAGCAGTGAAAGGAGCCTCAGGG - Intronic
1085761929 11:79248585-79248607 AGGCAGTAAAAGGATTTTCAGGG + Intronic
1087889530 11:103520952-103520974 AAGCTGTTAAAGATGTATCATGG + Intergenic
1091071467 11:132568106-132568128 AAGCACCAAAACGTATGTCATGG + Intronic
1091231705 11:133991890-133991912 ACGCAGGTAAAGGTGTGCCATGG - Intergenic
1091860316 12:3775646-3775668 AAGCAGTAAAAGGTATTTCTTGG - Intergenic
1091963580 12:4719834-4719856 AGACAGTACAAGGTGTGTCCAGG + Intronic
1095685819 12:45032012-45032034 AAGCAGTAAAGGGTGGGTGAAGG - Intronic
1096331251 12:50714951-50714973 AAGATGGAAAAGGTGTGTTAAGG + Intronic
1097649611 12:62280751-62280773 AGGCAGAAAATGGTGTGTCAAGG + Intronic
1097793549 12:63840149-63840171 AATAAGTAAAATGTGTGTGACGG - Intergenic
1099994257 12:89760221-89760243 AAGGAGCAAGAGGTGAGTCATGG + Intergenic
1100142733 12:91638180-91638202 AAGCAATACAAGGTGTGCCAAGG - Intergenic
1100426451 12:94491547-94491569 AAGAAGTAAAAACTGTGGCATGG - Intergenic
1100492805 12:95097662-95097684 ATGTAGTAAATGGTGTGGCATGG - Intronic
1101469650 12:104984538-104984560 AAGGAGTAAAATGTATGTAATGG - Intergenic
1104295626 12:127509565-127509587 AAGCAGTAAAAGATGTGCAGGGG + Intergenic
1107395663 13:40014499-40014521 AAGCAATTAAAAGTGTGTTAAGG - Intergenic
1108896132 13:55331320-55331342 TAGCATTACAAGGTATGTCAAGG - Intergenic
1110333363 13:74298270-74298292 AAGTAATAAATTGTGTGTCAGGG + Intergenic
1110404055 13:75128805-75128827 AAGCAATATAAGATGTGTAAAGG + Intergenic
1110617536 13:77558041-77558063 AAGCAATAAATGCTGTTTCATGG - Intronic
1111597087 13:90426346-90426368 AAGCTGTAAAGTCTGTGTCAAGG + Intergenic
1111650240 13:91081400-91081422 AATCAGTAAAATGTATATCAGGG + Intergenic
1113409709 13:110073855-110073877 AAGCAGAAAAAAGTATGGCAAGG - Intergenic
1116948005 14:50854155-50854177 AATCAGTAAAATGTGTGCTATGG + Intergenic
1118508435 14:66443146-66443168 CAGCAGCAAAAGGGGTGCCATGG - Intergenic
1119533276 14:75378749-75378771 AAGAATTAAAAAGTGTGTCTGGG + Intergenic
1119575798 14:75720794-75720816 TAGCAGTAAGAGGTATGTGATGG + Intronic
1119792562 14:77365756-77365778 TAGCAGGAAAAAGTGTGTGAAGG + Intronic
1119841582 14:77797430-77797452 AAGAAGAAAAATGTGTTTCAAGG - Intergenic
1120926705 14:89804186-89804208 AAGCATGAAAAGGAGTGTTAAGG + Intronic
1121730082 14:96180709-96180731 GAGCAGTAAAAGGCGTGTTGAGG + Intergenic
1126317351 15:47384376-47384398 AAGCAGATAAAGATGTTTCAGGG - Intronic
1127417942 15:58775354-58775376 AAACAGTAAATGGGGTGTGAAGG + Intronic
1130030828 15:80311955-80311977 AAGCACTAAAAGGTGTGTTAAGG - Intergenic
1131622736 15:94084340-94084362 AAGCAGATGAAGGTGTGGCAGGG + Intergenic
1133262203 16:4558234-4558256 CAGCAGTCAAAGGTGAGCCAGGG - Intronic
1137502637 16:49023253-49023275 AAGGAGTAACAGAGGTGTCAGGG + Intergenic
1137899807 16:52254901-52254923 AAGTAGTAGTAGGTGAGTCATGG + Intergenic
1138861361 16:60762194-60762216 AGGCAAGAAAAAGTGTGTCAGGG + Intergenic
1139202081 16:64988146-64988168 AAGCTGAAAAAGGTGAGTTAGGG - Exonic
1140227537 16:73090594-73090616 AAGCAGTAAAGGGTGGGGCGTGG + Intergenic
1141199425 16:81885644-81885666 AAGCTGTAAGAGGAGTGTTATGG - Intronic
1144647616 17:16986396-16986418 AAGAATAAAAAGGTGTGTTAAGG + Intergenic
1153212721 18:2785776-2785798 AAGAAGTATAATGGGTGTCAGGG - Intronic
1155059624 18:22217310-22217332 CAGCACTAAAAGGGGTGACAGGG - Intergenic
1155345916 18:24856478-24856500 AAGCAATCAAAGGTGTTTTAGGG + Intergenic
1155710349 18:28869618-28869640 AAGAAGTAAGAGGTGGGTTATGG - Intergenic
1156783889 18:40885200-40885222 AAGGAGAACAAGGTGAGTCAGGG - Intergenic
1159380568 18:67652010-67652032 TGGCAGTAAAAGCTGTGTCTTGG - Intergenic
1159752199 18:72316261-72316283 AAGAAGGAAAAAGTGTGTAATGG - Intergenic
1160448249 18:78943709-78943731 AAGAAGGAAAAGGCGTTTCAAGG - Intergenic
1161760293 19:6166213-6166235 AAGCAGAAAAATGTCTGGCAGGG + Intronic
1162285947 19:9738965-9738987 AAGAAGTGAAATGTGTGTCTTGG + Intergenic
1165397176 19:35570796-35570818 AAGGGGTATAAGGTGGGTCAGGG + Intergenic
1165588691 19:36946160-36946182 AAGCAGGAATTGGTGTTTCAGGG + Intronic
1166978442 19:46618814-46618836 AAGCAGAACAAGGGGTGTCTGGG - Intergenic
929016091 2:37496844-37496866 ATGCAGCAAAAGCAGTGTCAAGG - Intergenic
929400847 2:41579731-41579753 AGGCAGGAAAATCTGTGTCATGG - Intergenic
932224703 2:70030362-70030384 AAGCAGTAAAAGGTGGCCCGAGG - Intergenic
933977300 2:87521857-87521879 AAGCAGTAAAGGATGTGTGAGGG - Intergenic
936316522 2:111428948-111428970 AAGCAGTAAAGGATGTGTGAGGG + Intergenic
936473814 2:112822605-112822627 GAGCAGCAAAAGGTGGGTGAAGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937140823 2:119598686-119598708 CAGCTGTAAAAGGCGTGCCAAGG - Intronic
938206227 2:129426255-129426277 AGGCAGTAAAAGGTGTGGTATGG - Intergenic
938653082 2:133403819-133403841 CATCAGTAAAATGTGTTTCATGG - Intronic
938809362 2:134838171-134838193 AAGTAAGAAAAGGTGAGTCAGGG + Intergenic
939203959 2:139075966-139075988 CAGGAGTAAAAGCTGTGTCAAGG - Intergenic
939988056 2:148851499-148851521 AAGCAGTAAAGGGTGCAGCAGGG - Intergenic
940830727 2:158462245-158462267 AAACATTAAATGGTTTGTCAAGG - Intronic
942456636 2:176142628-176142650 AAGCAGTTAAAGGGGTGAGAAGG - Intergenic
946201113 2:218071295-218071317 AAGCAGGAAGATGTGTGTCGGGG - Intronic
947620946 2:231590721-231590743 AGTCAGTAAAAGGAGTGTGAAGG + Intergenic
1170547293 20:17445319-17445341 AGCCAGCAAAAGGTGTGCCAGGG - Intronic
1174761212 20:53208975-53208997 AACAAGTGAAAGGTGTGTCCTGG - Intronic
1175262183 20:57681537-57681559 AAGCAGTGAAAGGTCTGGGAGGG - Intronic
1177431370 21:20996595-20996617 AACCAGTAAAGGGTGTGAGAAGG + Intergenic
1177617719 21:23545795-23545817 AACCAGAAATAGGTGTGTTAGGG + Intergenic
1180862553 22:19094135-19094157 AAGCATGAAAAGGTGGGGCACGG + Intronic
1182665147 22:31952831-31952853 CACCAATAAAAGGTGTGGCAGGG - Intronic
1182807753 22:33089785-33089807 AAGCAGAAAAAGGTCAGGCATGG - Intergenic
952824734 3:37515400-37515422 AAGCAGTGAAAGGAGAGCCAGGG + Intronic
955556381 3:60142035-60142057 AAGGAATAAAAGGTGCATCAAGG + Intronic
955850078 3:63210930-63210952 AACCAGTAAAGGATGTGTGAAGG - Intergenic
958825977 3:99031565-99031587 AAGAAGTGAAAGGTCTATCAAGG + Intergenic
960927755 3:122812952-122812974 AGGGAGTAAAAGGTGTGTAAAGG + Intronic
961187740 3:124930717-124930739 AAGCAGTTATAGGTGTGCCCTGG - Intronic
962709996 3:138078207-138078229 GAGCAGTCCAAGGTGAGTCAGGG + Intronic
966621203 3:181966121-181966143 AAACAGTAAGAGGTGGGGCAGGG + Intergenic
969718782 4:8881687-8881709 AGGCAGAAGAATGTGTGTCATGG - Intergenic
970238034 4:13978634-13978656 AAGTAGGAAAATATGTGTCAAGG - Intergenic
970909069 4:21253211-21253233 AAGGAGTATAAGATTTGTCAAGG - Intronic
971114116 4:23623386-23623408 ATGCAGTAAAAGCAGTGTTAAGG + Intergenic
972095644 4:35343868-35343890 TAGCAGTAAAGTGAGTGTCATGG - Intergenic
973166678 4:47086796-47086818 AAGCAGTAAGAGGGCTGTCTTGG - Intronic
974154113 4:58048125-58048147 AAACAGTAAAAGGGGTGTCTTGG - Intergenic
976687062 4:87825749-87825771 ACGCAGGTAAATGTGTGTCATGG + Intronic
977245245 4:94623329-94623351 AAGCAGAAAAGTGTGTGCCAAGG - Intronic
977545876 4:98375984-98376006 CAGCAATAAAATTTGTGTCATGG - Intronic
978567187 4:110095590-110095612 CAGTGGTAAAAGGTGAGTCAAGG + Intronic
979023326 4:115531922-115531944 AAGGTGTAAAATGTCTGTCAAGG + Intergenic
979861863 4:125703968-125703990 AATGATTAAAAGATGTGTCAAGG + Intergenic
981068155 4:140507113-140507135 AAGCAATAGAAGTTGTGTCTTGG + Intergenic
982866593 4:160520969-160520991 AGACAGGAAAGGGTGTGTCAAGG - Intergenic
985626169 5:989707-989729 AAGCAATAAAATGTGTGACCAGG + Intergenic
985879660 5:2628666-2628688 AAGCCCTAGAAGGTGTGCCAGGG - Intergenic
987824675 5:23014513-23014535 AAGCAGCAAATGTTCTGTCAGGG - Intergenic
987960975 5:24808365-24808387 AGGCAGCAAAAGCTGTTTCATGG - Intergenic
990247805 5:53880955-53880977 AATCAGAAAAATGTGTGTCCAGG - Intergenic
996171711 5:120300862-120300884 GAGCAGTAAGAGGTGATTCATGG + Intergenic
997699583 5:135887640-135887662 AAACAGGAAAAGAAGTGTCACGG - Intronic
998246314 5:140509011-140509033 AAGAAGTAAAAGGAATTTCAGGG - Intronic
999904092 5:156120235-156120257 AAGCAGAAAGAGGTGTGTAGGGG + Intronic
1002338485 5:178497141-178497163 AAGAAGCAAATGGTTTGTCAAGG + Intronic
1002765087 6:232558-232580 AGGCAGTAAAATGTGAGTGATGG + Intergenic
1002962011 6:1924041-1924063 AAGAAGTAAAGGGTGTGTTTGGG - Intronic
1004833847 6:19508096-19508118 AAACAGTAAGAGCTGTGTGATGG - Intergenic
1006321093 6:33320000-33320022 AAGCAGCAGCAGGTATGTCAAGG - Exonic
1008010775 6:46465573-46465595 CTGCAGTGAAAGATGTGTCAGGG - Intronic
1012185681 6:96212958-96212980 AATCTGTAAAAGGAGTGTGATGG + Exonic
1013568207 6:111391365-111391387 AAACATTAAAAAGTGTTTCAAGG - Intronic
1014821752 6:125996444-125996466 AAACAGTAAAACATGTCTCACGG - Intronic
1016655048 6:146509159-146509181 TATCAGTAAATTGTGTGTCATGG + Intergenic
1017912919 6:158810136-158810158 TATCAATAAAAGGTGGGTCATGG + Intronic
1018726143 6:166614780-166614802 AAGCGGGAAAGGGTGTGACAGGG - Intronic
1022226572 7:28369633-28369655 AAGCAGTAAAAGGAATCTCAGGG - Intronic
1024547051 7:50530935-50530957 AATAAGTAAAAGTAGTGTCAAGG - Intronic
1024683436 7:51718240-51718262 AACCAGTAGAAGGTGAGTGACGG - Intergenic
1025170317 7:56750549-56750571 AAGCAATAAAAATTGTGTAATGG - Intergenic
1025701567 7:63825157-63825179 AAGCAATAAAAATTGTGTAATGG + Intergenic
1026401379 7:70016969-70016991 AATCATTAAAAAGTCTGTCAAGG - Intronic
1026656434 7:72260759-72260781 AAGTGGGAAAAGGGGTGTCATGG - Intronic
1027391862 7:77711951-77711973 AAGGAGTAAAACCTGTGTGAGGG + Intronic
1028420167 7:90623934-90623956 AAGCATGAAAAGGGGTTTCAGGG - Intronic
1028809054 7:95062759-95062781 AAGCAGAAAAAAGTGGGGCAGGG - Intronic
1029411216 7:100412442-100412464 GAGCAGGAGAAGGTATGTCAAGG - Intronic
1030894309 7:115038370-115038392 GAGCGCTAAGAGGTGTGTCAGGG + Intergenic
1033778815 7:144645522-144645544 AGGCAGTAAAATGAGGGTCAAGG - Intronic
1033812228 7:145029414-145029436 AAGCAGTAGAAGATGTCTCTAGG + Intergenic
1034850246 7:154486748-154486770 AAGCAGAGAGAGGTGTGTCTTGG + Intronic
1036282635 8:7414771-7414793 GAGCAGAAAAAGGTGTTTCAAGG + Intergenic
1036338838 8:7896778-7896800 GAGCAGAAAAAGGTGTTTCAAGG - Intergenic
1040621428 8:49096609-49096631 AAGCAGTTAAAGGAGTGTTTAGG - Intergenic
1042035021 8:64523448-64523470 GAGCAGAAAAAGGTCTGTGATGG + Intergenic
1045548126 8:103146402-103146424 AAGCGGTAACAGGTAAGTCAAGG - Intronic
1046499067 8:115052417-115052439 AAACAGGTAAACGTGTGTCATGG - Intergenic
1050664929 9:7925052-7925074 AAGTAGTTAAAGTAGTGTCATGG - Intergenic
1051871453 9:21742367-21742389 AAGTAGAAAAAGGAGTGTCAGGG + Intergenic
1053285237 9:36845940-36845962 GAGCAGTAAAAGGTCAGACATGG - Intronic
1053561251 9:39197099-39197121 AAGCAGAAAAAAATCTGTCAAGG + Intronic
1053825344 9:42017337-42017359 AAGCAGAAAAAAATCTGTCAAGG + Intronic
1054135868 9:61421848-61421870 AAGCAGAAAAAAATCTGTCAAGG - Intergenic
1054605219 9:67170020-67170042 AAGCAGAAAAAAATCTGTCAAGG - Intergenic
1054844801 9:69782736-69782758 ATACAGTAAAAGGAATGTCAAGG - Intergenic
1056125934 9:83537057-83537079 AATCAGGAAAGGTTGTGTCAGGG - Intronic
1059192283 9:112337716-112337738 CATCAGAAAAAGGTGTGTCAGGG - Intergenic
1059524132 9:114974244-114974266 AAGAAGGAAAAGGTGTTTCTAGG + Intergenic
1061603425 9:131688448-131688470 TAGCAGTATAAAGTGAGTCAAGG - Intronic
1185885024 X:3774914-3774936 AAGAAGTCAAAGGTGGGGCACGG + Intergenic
1186853520 X:13603476-13603498 ATTCAGTAAAAGGGGAGTCAAGG - Intronic
1187065506 X:15833338-15833360 AAGCAGTAAAAGGTGTGTCAGGG - Intronic
1187239089 X:17496192-17496214 AAGCAGTAGAAGGTGAGGAATGG + Intronic
1187270247 X:17774025-17774047 AAGCAGTAATAGATGTGTAGAGG - Intergenic
1187803881 X:23096735-23096757 ATGCAGTAAAAGCAGTGTTAAGG + Intergenic
1189125470 X:38441285-38441307 AAGCAGTGAAATGTGGTTCATGG + Intronic
1190470658 X:50775822-50775844 AAGCAGTGGAAGGTGTGGTATGG + Intronic
1192259034 X:69492916-69492938 AAGCAATAGAAGCTGAGTCATGG + Intergenic
1194230006 X:91310010-91310032 AAGCAGTTAAAGATGTGTTCTGG + Intergenic
1194522664 X:94937399-94937421 AAGAAGAAAAAGATGTCTCAGGG - Intergenic
1195025349 X:100871504-100871526 AAACAGAAAAATGTGTGTCAGGG - Intronic
1199608746 X:149596299-149596321 AAGCAGTAACAAGTGTGGCAAGG + Intergenic
1199630376 X:149773061-149773083 AAGCAGTAACAAGTGTGGCAAGG - Intergenic
1200207597 X:154328634-154328656 ATGCAGAAAACAGTGTGTCAGGG + Intronic