ID: 1187066198

View in Genome Browser
Species Human (GRCh38)
Location X:15840698-15840720
Sequence GTGGGGGGTGGTGATGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 388}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187066198_1187066212 16 Left 1187066198 X:15840698-15840720 CCAACTACATCACCACCCCCCAC 0: 1
1: 0
2: 1
3: 45
4: 388
Right 1187066212 X:15840737-15840759 TCTAGCTTAAAATAGGTGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 110
1187066198_1187066213 17 Left 1187066198 X:15840698-15840720 CCAACTACATCACCACCCCCCAC 0: 1
1: 0
2: 1
3: 45
4: 388
Right 1187066213 X:15840738-15840760 CTAGCTTAAAATAGGTGGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 124
1187066198_1187066210 12 Left 1187066198 X:15840698-15840720 CCAACTACATCACCACCCCCCAC 0: 1
1: 0
2: 1
3: 45
4: 388
Right 1187066210 X:15840733-15840755 AAAATCTAGCTTAAAATAGGTGG 0: 1
1: 0
2: 0
3: 23
4: 277
1187066198_1187066211 15 Left 1187066198 X:15840698-15840720 CCAACTACATCACCACCCCCCAC 0: 1
1: 0
2: 1
3: 45
4: 388
Right 1187066211 X:15840736-15840758 ATCTAGCTTAAAATAGGTGGTGG 0: 1
1: 0
2: 1
3: 9
4: 101
1187066198_1187066209 9 Left 1187066198 X:15840698-15840720 CCAACTACATCACCACCCCCCAC 0: 1
1: 0
2: 1
3: 45
4: 388
Right 1187066209 X:15840730-15840752 CCAAAAATCTAGCTTAAAATAGG 0: 1
1: 0
2: 4
3: 25
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187066198 Original CRISPR GTGGGGGGTGGTGATGTAGT TGG (reversed) Intronic
900503386 1:3017324-3017346 GTGGGGGGTGCTGGCGGAGTGGG + Intergenic
900649953 1:3725819-3725841 GTGGGGGGTGGATATGTGGGTGG + Intronic
900975148 1:6012048-6012070 GTGGGTGGAGGTGATGAAGGTGG + Intronic
901116621 1:6850650-6850672 GTGGGGCGTGGTGATGAGGTAGG + Intronic
901463441 1:9405391-9405413 GTGGGTGGGGGTGATAGAGTTGG + Intergenic
901741894 1:11347258-11347280 CTGGGGGGTGGTGAGGAATTGGG - Intergenic
902406239 1:16185126-16185148 GTGGTGTGTGGTGATGAAATTGG - Intergenic
902542734 1:17166200-17166222 GTGGGTGGTGGGGATGTTGGTGG - Intergenic
902560614 1:17274832-17274854 GTTGGGGGTGGTGATGATGGTGG + Intronic
903558705 1:24212024-24212046 GAGGGAGGTGGTGATGGAGGTGG + Intergenic
903572857 1:24319226-24319248 GTGGGGGGTGGAGATGAGGGAGG - Intergenic
904570378 1:31459890-31459912 GTGGGGGATGGTGGTCTAGAGGG - Intergenic
904925777 1:34047160-34047182 AAGGAGGGTGGTGATGGAGTGGG - Intronic
905393530 1:37653020-37653042 GTGGGGGGTGGGGGTGGGGTGGG - Intergenic
905706184 1:40060650-40060672 GGGGGTGGTGGTGATGACGTAGG - Intronic
906296310 1:44651045-44651067 GTGGGGGTTGGGGGAGTAGTGGG + Exonic
906678081 1:47707922-47707944 GGGGGGGGTGGGGAGGGAGTAGG + Intergenic
908139118 1:61164788-61164810 GTGGGAGATGGTGAAGAAGTGGG + Intronic
909526288 1:76626514-76626536 GGGGAAGGTGGTGATGTACTTGG - Intronic
909684024 1:78325504-78325526 CTGAGGAGTGGTGATGTACTGGG + Intronic
909766690 1:79365308-79365330 GTGAGGGGTGGTGTTGGAGCTGG - Intergenic
910520451 1:88115767-88115789 CTGGGAGGTGGTGGGGTAGTGGG - Intergenic
910867146 1:91799036-91799058 CTGGGAGGTTGTGGTGTAGTGGG - Intronic
911218254 1:95218906-95218928 GTGGGGAGTGACGATGTTGTAGG + Intronic
912684365 1:111750235-111750257 GTGGGGGGTGGCTGTGCAGTGGG + Intronic
913583117 1:120246677-120246699 GTGGTGGTTAGTGATGAAGTAGG + Intergenic
913625055 1:120651653-120651675 GTGGTGGTTAGTGATGAAGTAGG - Intergenic
914565105 1:148858495-148858517 GTGGTGGTTAGTGATGAAGTAGG + Intronic
914607719 1:149271749-149271771 GTGGTGGTTAGTGATGAAGTAGG - Intergenic
915284032 1:154841704-154841726 TTCGGGGATGGGGATGTAGTAGG - Intronic
915718772 1:157968322-157968344 GTCGGTGGTGGTGATGGAGAGGG - Intergenic
916004610 1:160648072-160648094 GTGGGGGTTGGGGAAGAAGTGGG - Intergenic
916091428 1:161310211-161310233 GTGGGGGGTGGTGAGGGAGAGGG + Intergenic
918206016 1:182310077-182310099 GTGGGAGGTGGTGAAGAAGCAGG + Intergenic
918288296 1:183080447-183080469 GTGGGGCAGGGTGAGGTAGTGGG + Intronic
918474743 1:184911971-184911993 GTGGTGCCTGGTGATGTTGTGGG - Intronic
920098262 1:203500290-203500312 GTGGGTGGTGGTGGTGGAGGTGG - Intronic
920846055 1:209593925-209593947 GTGGGGGGTGGTGAGTGGGTAGG - Intronic
922353102 1:224750924-224750946 GTGGGCGGTGGGGATTGAGTAGG + Intergenic
923225499 1:231935332-231935354 GTGGGGCGTGGTGAGGAAGGAGG + Intronic
923652638 1:235888414-235888436 GTGGGGGGTGGTGAGGAGGAGGG - Intergenic
1062950143 10:1492830-1492852 GTAGGGGGAGGTGATGTGCTTGG + Intronic
1063606463 10:7526966-7526988 GTGGGGGTTGTTTATGTTGTGGG + Intergenic
1063613491 10:7582848-7582870 GTGGGGGGTGGGGCAGAAGTAGG + Intronic
1064583525 10:16817225-16817247 GTGCGGGGAGGGGATGGAGTGGG + Exonic
1064678417 10:17784848-17784870 GTGGGGAATGGAGATGAAGTGGG + Intronic
1065135140 10:22660116-22660138 GTGGGTGCTGGGGATGTAGGGGG - Intronic
1068657066 10:59586841-59586863 GTGGGGAGTGGTTATTTAGTGGG - Intergenic
1069592464 10:69650605-69650627 CTGGGGGGTGGGGGTGCAGTGGG + Intergenic
1069613617 10:69792143-69792165 GTGGGTGGTGGTGATGGTGACGG - Intergenic
1070039113 10:72757414-72757436 GTGGGGGTTGGGGAAGTAGGAGG - Intronic
1071667803 10:87577283-87577305 GTGGGGGGTGGTTGGGTAGGGGG + Intergenic
1071880162 10:89888636-89888658 GTGGGGGGTGGGGGGGTAGGGGG - Intergenic
1073055804 10:100700477-100700499 GAGGGGAGTGGTGATGAAGATGG - Intergenic
1073177566 10:101565710-101565732 CTGGGGGGTGGTGATGAGGTGGG - Intergenic
1073834189 10:107421972-107421994 GTGGGGGTTGTTGATATACTTGG + Intergenic
1074707853 10:116151434-116151456 GTCAGTGGTGGTGATGTAGTGGG - Intronic
1077307005 11:1872970-1872992 GTGGGGGGTGGGGGTATAGGGGG + Intronic
1078394647 11:10969921-10969943 GTGGGGAGTGGTGAGGGAATGGG + Intergenic
1079455789 11:20635154-20635176 GTGGGTGTTGATGATGTAGGGGG + Intronic
1080404691 11:31968275-31968297 GGGGAGGGTGGTGATGAAGGGGG + Intronic
1080455142 11:32411946-32411968 GCTGGGGGTGGAGATGGAGTAGG + Intronic
1081365425 11:42229510-42229532 GTGGAGAGTGGAGATGGAGTTGG + Intergenic
1081534317 11:43986294-43986316 GTGGGGGGTGGGGGTGGGGTGGG - Intergenic
1083289002 11:61679765-61679787 GTGGGGGGTGGGGGGGTGGTAGG + Intergenic
1083916911 11:65752504-65752526 GTGGGGGCTGGTGATGGAAGGGG - Intergenic
1083989666 11:66239180-66239202 CTGGAGGGTGGTGATGTGGAGGG - Exonic
1084373442 11:68760173-68760195 GTGGGGCGTGGTGATGGGATGGG - Intronic
1084470189 11:69354902-69354924 ATGGGGGGTGGGGAAGTTGTGGG + Intronic
1088469412 11:110177257-110177279 GTGGGAAGTGGTGAGGTGGTGGG + Intronic
1089775152 11:120830856-120830878 GTGGGGGGTGGGGGTGATGTGGG - Intronic
1089777439 11:120848169-120848191 GAGGGGGCAGGGGATGTAGTAGG + Intronic
1090634548 11:128682553-128682575 GTGGGGGGTGGTGATGGGAAGGG - Intergenic
1091174234 11:133545537-133545559 GTGGGGGGTAGTGAAGCAGCTGG + Intergenic
1091455557 12:604818-604840 TTGAGGGGTGGTGAAGGAGTCGG - Intronic
1092278858 12:7084727-7084749 GTTGGTGGTGGTGATGGTGTTGG + Intronic
1093661958 12:21767562-21767584 GTGGGGGATGGGGATGGTGTGGG - Intronic
1096584289 12:52609507-52609529 CTTGGGGGTGGTAATGTTGTTGG - Intronic
1096651009 12:53061960-53061982 GAGTGGGGTGGGGATGAAGTTGG + Intronic
1096795040 12:54071469-54071491 GTGGGGGGTGGGGGAGTAGGGGG + Intergenic
1096867450 12:54573249-54573271 GTGAGGGGTGGGGATGTGGCAGG + Intronic
1097173388 12:57129355-57129377 GTGGGGGGTTGTGAGGATGTAGG - Intronic
1097251437 12:57634619-57634641 GTGGAGGGAGCTGATGGAGTTGG + Intergenic
1097947014 12:65380291-65380313 TTGGGGGGTCCTGATATAGTTGG + Intronic
1098162261 12:67657015-67657037 GTTGGGGGCGGTGGTGTTGTTGG + Intronic
1099580909 12:84446050-84446072 GTTTGGGGTGGTGATGGAATAGG - Intergenic
1100492695 12:95096661-95096683 GTGGGTGATGATGTTGTAGTTGG - Intronic
1101179916 12:102204826-102204848 GTGTGTGGAGTTGATGTAGTTGG + Intergenic
1103478658 12:121236693-121236715 GTGGGGGCTGGTGTGGTGGTGGG + Intergenic
1103722836 12:122983754-122983776 GTGGGGCGTGGGGGTGTGGTGGG + Exonic
1103948867 12:124541072-124541094 GTGGGGAGTGGAGATGGAGGGGG + Intronic
1103949011 12:124541514-124541536 GTGGGGAGTGGAGATGGAGAGGG + Intronic
1103949136 12:124541855-124541877 GTGGGGAGTGGAGATGGAGGGGG + Intronic
1106176776 13:27338528-27338550 GTGGGGTGTGGGGATGTGGAGGG - Intergenic
1106307124 13:28522656-28522678 GTGAGGGGTGTTGGTGTTGTAGG - Intergenic
1106511686 13:30418670-30418692 GTGGGGAGTGCTGATTTAGAGGG - Intergenic
1107755297 13:43615032-43615054 GTGGGGGATGGGGAAGTGGTAGG + Intronic
1108602498 13:52006856-52006878 GTGGGAGGTGGTGCTCGAGTGGG - Intronic
1109764209 13:66871815-66871837 GGGGGGGGTGGTAATGAAATAGG - Intronic
1110046139 13:70833852-70833874 GGTGGTGGTGGTGATGTATTTGG + Intergenic
1110625484 13:77650852-77650874 GTTGGGGGTGGTGGTGCAGATGG + Intergenic
1110779799 13:79451685-79451707 GTGGGAGGTGGTGGTGGAGAGGG + Intergenic
1111083265 13:83340261-83340283 GTGGGGAGTGGGCATGCAGTTGG + Intergenic
1113709706 13:112455205-112455227 GAGGGGAGTGGTGCTGAAGTGGG - Intergenic
1113987129 13:114326993-114327015 GTGGGGGGTGGGGATGGGGAGGG - Exonic
1114748701 14:25179585-25179607 CTGAGGGGTGGTGTTTTAGTTGG - Intergenic
1115126575 14:30002163-30002185 TTGGGGGGCGGTGATGGGGTGGG + Intronic
1115237484 14:31221839-31221861 GTTGGGGGTGGTGCTGGGGTCGG + Intergenic
1115890012 14:38016022-38016044 GAGGAGGGTGGTGATGGAGAAGG + Intronic
1116984298 14:51203447-51203469 GGGTGGTGTGGTGATGCAGTGGG + Intergenic
1118639320 14:67777619-67777641 GAAGTGGGTGGTGAGGTAGTTGG + Exonic
1119030472 14:71188350-71188372 CTGGGGGGTGGTGAGGTATGCGG + Intergenic
1119253009 14:73173494-73173516 GTTGGAGGTGGTAATGTGGTTGG + Intronic
1119663619 14:76468396-76468418 TTGGGGGGTGGTGGTGTTGGGGG - Intronic
1119809566 14:77505420-77505442 GTGTGGGGAGGTGAGGTAGTGGG - Intergenic
1120877969 14:89392191-89392213 GTGGGGGCTGGTGATAGATTTGG - Intronic
1121586733 14:95067940-95067962 ATGGAGAGTGGGGATGTAGTGGG - Intergenic
1122791357 14:104185450-104185472 GTGTGGGGTGGGGGTGGAGTGGG + Intergenic
1123735310 15:23178300-23178322 GTGGGGGGTGGGGAAGAAGAGGG - Intergenic
1123940081 15:25212523-25212545 GGGGGGGGTGGTGATGGGGTCGG + Intergenic
1124296878 15:28512055-28512077 GTGGGGGGTGGGGAAGAAGAGGG + Intergenic
1124399802 15:29338252-29338274 GAGGAGGGTGGTGATGAGGTAGG + Intronic
1124466969 15:29948941-29948963 GGGGGTGGTGGTGGTGGAGTTGG - Intronic
1125095216 15:35842691-35842713 CTGGGGGGTGGTGAGGGAGAAGG - Intergenic
1125118421 15:36122909-36122931 GTGGGGAATGGTGATGTCTTTGG + Intergenic
1125598742 15:40903928-40903950 GTCGGTGGTGGTGATGGAGGTGG + Exonic
1126134252 15:45375769-45375791 GCGGGGGGTGGTGGGGTAGTGGG + Intronic
1129388079 15:75206855-75206877 GTGGTGGGTGGTGGGGTGGTGGG - Exonic
1129622277 15:77158964-77158986 GTGGGAGGTGGTGATGTTGGTGG + Intronic
1129669084 15:77597186-77597208 GTGGGGGGTGGGGAGGGAGCTGG + Intergenic
1129934822 15:79439065-79439087 GTGTGGGGTGTTGATGGGGTGGG + Intronic
1130540582 15:84818135-84818157 GTGGGGGCTGGTGAGATAGGGGG + Intronic
1130828794 15:87578504-87578526 GTGGGAGGTGGTTAGGTAGCTGG - Intergenic
1131209357 15:90480280-90480302 GTGAGGGATGGTGGTGTGGTGGG + Intronic
1132204315 15:99976049-99976071 GCGGGGGGAGGTGATGGTGTTGG + Exonic
1132522408 16:397668-397690 GTGTGGGGGGGTGAGGGAGTCGG + Intronic
1132522429 16:397706-397728 GTGTGGGGGGGTGAGGGAGTCGG + Intronic
1133289533 16:4710121-4710143 GTTGGGGGTGGGGAGGTAGTGGG + Intronic
1135974554 16:27099437-27099459 GTGGGAGGTGGTGCTGCAGTGGG - Intergenic
1136189266 16:28606096-28606118 CTGGGGGACGGTGGTGTAGTTGG + Exonic
1136317766 16:29464278-29464300 CTGGGGGACGGTGGTGTAGTTGG - Exonic
1136432341 16:30203623-30203645 CTGGGGGACGGTGGTGTAGTTGG - Exonic
1136605168 16:31329091-31329113 CTGGGGGGTGGAGATGGGGTGGG - Intronic
1137529459 16:49268847-49268869 GGTGGGGGTGGAGATGGAGTTGG - Intergenic
1137586498 16:49666967-49666989 GTCGGTGTTGGTGATGGAGTCGG - Intronic
1138141038 16:54568697-54568719 GAGGGAGGTGCTGATGTATTGGG + Intergenic
1138262807 16:55637369-55637391 GTGGGTGGTGGTGATGGGGGTGG + Intergenic
1138423173 16:56913001-56913023 GTGGGAGGAGGTGAGGTCGTGGG + Intronic
1138449767 16:57086690-57086712 GTGGGGTGGGGTGCTGAAGTAGG + Intergenic
1138454890 16:57115578-57115600 GTGTGGGGTGGGGATGGAGGGGG - Intronic
1140015120 16:71175084-71175106 GTGGGTGGTGGTGGTGTAGATGG - Intronic
1140840899 16:78838181-78838203 GTGGGTGGTGGTGAAGCAGAGGG + Intronic
1141572871 16:84944812-84944834 GTGGGTGCTGGAAATGTAGTGGG + Intergenic
1143338899 17:6194068-6194090 GGGGGTGGTGGTGATGGAGATGG + Intergenic
1143338924 17:6194152-6194174 GGGGGTGGTGGTGATGGAGGTGG + Intergenic
1143338938 17:6194197-6194219 GGGGGTGGTGGTGATGGAGGTGG + Intergenic
1143338964 17:6194284-6194306 GGGGGTGGTGGTGATGGAGGTGG + Intergenic
1143339006 17:6194410-6194432 GGGGGTGGTGGTGATGGAGGTGG + Intergenic
1143339016 17:6194455-6194477 GGAGGTGGTGGTGATGGAGTTGG + Intergenic
1143576890 17:7798955-7798977 GTGGGGGGTGCTGAAGTGGGAGG + Intronic
1145887260 17:28391059-28391081 GTGAGGGGAGGTGATGGGGTAGG + Intronic
1147484816 17:40802339-40802361 GTGGAGGGTGGGGATGAAGAGGG + Intergenic
1147910832 17:43855053-43855075 GTGGGGGGTGGTGGTGCGGGGGG - Intronic
1148082414 17:44974862-44974884 GTTGGGGATGGGGATGGAGTAGG + Intergenic
1148218120 17:45845037-45845059 CCGGGGGAGGGTGATGTAGTCGG - Exonic
1148280753 17:46345358-46345380 GTGGGGGGTGGCGCTGAGGTGGG - Intronic
1148302981 17:46563293-46563315 GTGGGGGGTGGCGCTGAGGTGGG - Intronic
1149646540 17:58245494-58245516 GTGGGGAGGGGTGAAGGAGTGGG - Intronic
1150181569 17:63126835-63126857 GTGGGGGGTGGGGAGGTAAAAGG - Intronic
1151120638 17:71789000-71789022 GTGGGGGGTAGTCATATAATAGG + Intergenic
1151418693 17:73983620-73983642 GTGGGGGGTGGTGGTGGGGGTGG - Intergenic
1151681454 17:75624888-75624910 GTAGTGGGTGCTGATGTAGGTGG - Intergenic
1151976279 17:77485109-77485131 GTGGGTGGTGGTGGTGATGTGGG + Intronic
1152021262 17:77781397-77781419 GTGGGGGGGGCTGCTGGAGTGGG - Intergenic
1152504719 17:80741290-80741312 GTGGAGGGTGGTGCTGGTGTGGG + Intronic
1152550353 17:81026735-81026757 GTCTGGGGTCGTGATGCAGTGGG - Intergenic
1152619973 17:81358270-81358292 GTGTGGGGTGATGATGAACTTGG + Intergenic
1152634417 17:81424732-81424754 GGTGGTGATGGTGATGTAGTTGG + Intronic
1152634446 17:81424896-81424918 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634464 17:81425009-81425031 GTGGTTGGTGATGATGTGGTTGG + Intronic
1152634475 17:81425052-81425074 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634515 17:81425217-81425239 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634566 17:81425426-81425448 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634597 17:81425557-81425579 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634616 17:81425628-81425650 GTGGTTGGTGGTTATGTGGTTGG + Intronic
1152634619 17:81425643-81425665 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634628 17:81425683-81425705 GTGGTTGGTGGCGATGTGGTTGG + Intronic
1152634637 17:81425726-81425748 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634642 17:81425755-81425777 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634665 17:81425859-81425881 GTGGTGGTGGGTGATGTGGTTGG + Intronic
1152634668 17:81425874-81425896 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634679 17:81425945-81425967 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634687 17:81425985-81426007 GTGGTTGGTGATGATGTGGTTGG + Intronic
1152634705 17:81426053-81426075 GTGGTGGTGGGTGATGTGGTTGG + Intronic
1152634708 17:81426068-81426090 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634734 17:81426183-81426205 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634736 17:81426198-81426220 GTGGTTGGTGATGATGTGGTTGG + Intronic
1152659520 17:81535807-81535829 GAGGGGGATGGTGATGGAGATGG - Intronic
1152659533 17:81535843-81535865 GAGGGGGATGGTGATGGAGATGG - Intronic
1153340267 18:3966262-3966284 TTGGTGGGTGGGGAAGTAGTAGG + Intronic
1153507690 18:5818818-5818840 GTGGGGGGTGGGGAGGTGGGGGG + Intergenic
1154172448 18:12061425-12061447 GTGGGGGGTGGTGTTGTCTGGGG + Intergenic
1154424237 18:14259685-14259707 GTAGGGGGTGGAGATGTGTTGGG + Intergenic
1154429636 18:14298421-14298443 GTAGGGGGTGGAGATGTGTTGGG + Intergenic
1157539260 18:48488054-48488076 GTGGGTGATGGTGATGTAAGAGG - Intergenic
1157762056 18:50272640-50272662 GTGAGGGGTGGGGAAGGAGTGGG - Intronic
1158856494 18:61547713-61547735 GTGTGGGGCGGGGGTGTAGTGGG - Intronic
1159423787 18:68257774-68257796 GTGGGGGGATGTGAGGCAGTAGG - Intergenic
1159923468 18:74246952-74246974 GTGGGGGATGGGGAGATAGTGGG - Intergenic
1160056375 18:75485386-75485408 TTGAGGGGTGGTGATGTAAATGG - Intergenic
1160629720 18:80238340-80238362 GTGGGGTGTGGGGAGGGAGTAGG + Intronic
1160808140 19:1001416-1001438 TTGGGGGGTGGGAATGGAGTCGG - Intronic
1162323631 19:9985805-9985827 GTGGGGGGTGGAGATGGATATGG - Intronic
1162337327 19:10070051-10070073 GTGGGAGGAGGTGATGTGGAAGG + Intergenic
1162907154 19:13830842-13830864 GTGGCTGGTGGTGATGTAGGCGG - Exonic
1163717272 19:18879679-18879701 GTGGGGTTTGGTGAGGTAGGTGG - Intronic
1164572599 19:29385201-29385223 GTGAGGGGTGGTGCTGAAATGGG + Intergenic
1168678474 19:58296293-58296315 GTGGGGGCTGGTCACGTAATTGG - Exonic
929083604 2:38146649-38146671 GTGGGGGGAGGTGAGGCAGGAGG - Intergenic
930136453 2:47906863-47906885 GCGGGGGTTGCTGATGTAATGGG + Intergenic
930753853 2:54956694-54956716 GTGGTGGGTTTTGATGTAGCTGG - Intronic
931561537 2:63567008-63567030 GTCGGGGGTGGTGTGGTTGTGGG + Intronic
932617661 2:73244971-73244993 GTGGGTGGTGGAGGGGTAGTAGG + Intronic
933993798 2:87652684-87652706 ATGGGGCATGGTGTTGTAGTTGG - Intergenic
934722121 2:96587117-96587139 TTGGGGGGTGGTGTTGAAGTAGG + Intergenic
935843196 2:107136638-107136660 GTGGTGGGTGGTTAGGAAGTGGG - Intergenic
936300066 2:111298199-111298221 ATGGGGCATGGTGTTGTAGTTGG + Intergenic
937267380 2:120625063-120625085 GTGGGTGGTGGGGAGGTACTGGG + Intergenic
937981592 2:127619219-127619241 GTGGGGGGTGGTTGGGTTGTGGG + Intronic
937981617 2:127619288-127619310 GTGGGGGGTGGTTGGGTTGTGGG + Intronic
938036378 2:128038377-128038399 GTGGGGGAAGGTGATTTAGCAGG - Intergenic
938571581 2:132566664-132566686 GTGTGGGCTGGTGAAGGAGTGGG + Intronic
939401306 2:141698158-141698180 GTGGAGGGTGGCGAGGTAGGGGG + Intronic
939819591 2:146940238-146940260 GGGGGGGGTGGTGCTGCAGGAGG + Intergenic
939929447 2:148215244-148215266 TTGGGGGCTGGCGATGTAGCAGG - Intronic
940416840 2:153432712-153432734 CTGGGGGGTGGGGAGGTGGTTGG + Intergenic
940423737 2:153508393-153508415 ATGGGGGATGGTGGTGTGGTTGG + Intergenic
941153082 2:161939620-161939642 GTTGGGGGTGGGGAGGTAGAAGG - Intronic
942527898 2:176875137-176875159 GTGGTGGGTGGTGGTGTTGTGGG + Intergenic
942838727 2:180334031-180334053 GTGGGGGGTGGAAATGGAGATGG + Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946352255 2:219162769-219162791 GTTGGGGGTGGTGGTGCAGGGGG + Intronic
946357183 2:219195248-219195270 TTGGGGGGTGGGGAGGTAGGAGG - Intronic
946832535 2:223741073-223741095 GTGGGAAGTGGGGATGGAGTGGG + Intergenic
947157252 2:227174998-227175020 ATGGGGTGTGGTGATGGAGAAGG + Intronic
947354674 2:229279771-229279793 GTGGGGGGTGGTGCTGCAGGAGG + Intergenic
948339779 2:237240275-237240297 GTGGGGGTTGGGAATGGAGTGGG - Intergenic
949022454 2:241749189-241749211 GTGGGAGGTGGTGGTGGTGTTGG - Intronic
1169888053 20:10423310-10423332 GTGGGGGGTGCTGAGGTAGGAGG + Intronic
1170434301 20:16309380-16309402 GTGGTGGGTGGTGATAGTGTAGG - Intronic
1171064420 20:22000113-22000135 GTGGGAGGTGGTGATGAAGAGGG + Intergenic
1171344259 20:24453576-24453598 GTGGGGGGTGGGGTGGTGGTGGG - Intergenic
1172047592 20:32091618-32091640 GTGGGGGGTGGGGACGAAATGGG - Intronic
1173613761 20:44389555-44389577 GTGGGTGGTGGAGATGCAGCAGG - Intronic
1173616370 20:44405921-44405943 GAGTGGGGAGGTGATGGAGTGGG + Intronic
1173828489 20:46062763-46062785 GTGGGGGGTGCAGATGGAGTGGG + Exonic
1173869419 20:46332281-46332303 GTGGGGGGTAGGGATGCAGAGGG - Intergenic
1174457610 20:50660861-50660883 GTGGGGGGTGCTGAGGTGGGAGG - Intronic
1174718563 20:52786317-52786339 GTGGGTGGTGGTGATATAGTAGG + Intergenic
1175587880 20:60159870-60159892 GTTGGGGGCGGGGATGCAGTGGG + Intergenic
1175669071 20:60885831-60885853 GTGGGGGGTGGTGGGGAGGTGGG + Intergenic
1175967807 20:62668365-62668387 GGGGGGGGTGATGATGTGGCTGG + Intronic
1177185907 21:17795794-17795816 TTGGAGGGTGGTGATGTACTGGG - Intronic
1179038371 21:37779968-37779990 GGGTGGGGTGGTGAGGCAGTAGG + Intronic
1180072294 21:45442587-45442609 GTGGGCGGTGGTGCTGGTGTGGG + Intronic
1180072388 21:45442902-45442924 GTGGGTGGTGGTGCTGGTGTGGG + Intronic
1180072402 21:45442959-45442981 GTGGGTGGTGGTGCTGGTGTGGG + Intronic
1181291569 22:21798317-21798339 GTGGGGGGTGCTGAGGTGGGTGG + Intronic
1181559872 22:23693883-23693905 GCAGGAGGTGGTGATGCAGTTGG - Exonic
1182428185 22:30285847-30285869 GTTGAAGGTGCTGATGTAGTAGG + Exonic
1183040329 22:35173000-35173022 GTGGGTGGGAGTGAGGTAGTGGG + Intergenic
1183219605 22:36504187-36504209 CTGGGGGAGGGTGATGGAGTCGG + Exonic
1183314859 22:37131354-37131376 TTGGGGGGTGGGGATGAGGTAGG - Intronic
1185213754 22:49586998-49587020 GTTTGGGGTGGTGATGCAGGGGG + Intronic
952192865 3:31042533-31042555 GTGGGGGGTGGTGCTGATCTAGG + Intergenic
952557866 3:34553879-34553901 CTGGGGTGTGGTGATGGAGGTGG - Intergenic
953157573 3:40388485-40388507 GTGAGGGGTGGGGGTGTTGTAGG - Intronic
954139055 3:48595627-48595649 GTGGGGGGTGGGGCTGCAGTTGG + Intergenic
954601874 3:51876482-51876504 GTGGGGGATGGGGAAATAGTGGG + Intergenic
954646506 3:52134965-52134987 CTGGGAGGTGGCGATGTGGTGGG - Intronic
954725082 3:52601584-52601606 GTGGGGGGTGGGGAGGAGGTGGG + Intronic
954758325 3:52855307-52855329 GTGGGGTATGGTGTTGGAGTGGG - Intronic
955175697 3:56611548-56611570 GTGGGGGGTGGGCATGAATTGGG - Intronic
956322380 3:68011127-68011149 GTGGGGGGTGGTGGGGGGGTGGG + Intronic
957267392 3:77984541-77984563 GTGGGGGGTTGTGGTGGAGATGG - Intergenic
959109393 3:102103919-102103941 GCTAGGGGTGGTGAGGTAGTGGG + Intronic
960973149 3:123153646-123153668 ATGGGGGGTGGGGGTGTAGAGGG - Intronic
961391085 3:126552711-126552733 GTGGGGGGTGAGCATGGAGTGGG + Intronic
961656580 3:128445732-128445754 GGTGGGGGTGGTGATGGAGGTGG + Intergenic
961957012 3:130814919-130814941 GTGGGGGGTGGTGCGGTGCTTGG + Intergenic
962351691 3:134661030-134661052 GATGGGGGTGGTGAGGAAGTGGG - Intronic
964398028 3:156268014-156268036 ATGGGGGGTGGGGAGGAAGTGGG - Intronic
965624441 3:170672770-170672792 GTGGTAAGTGGTGATGTCGTGGG + Intronic
966318068 3:178671087-178671109 GTGGGGGGTGGTGGTGAGGGGGG - Intronic
966630012 3:182062026-182062048 GTGGTGGGTAGGGATGGAGTTGG + Intergenic
966816765 3:183896166-183896188 GTGGTGGGTGGGGCTGTGGTGGG - Intergenic
966976849 3:185092432-185092454 TTGGGGGGAGGTGAGGTAGGTGG - Intronic
967226906 3:187300902-187300924 GTTGGGGGAGGTAATGTGGTAGG - Intergenic
967862275 3:194161107-194161129 GTGGGGGGTGGAGAGGGAGGTGG - Intergenic
968658192 4:1787574-1787596 GTGGGTGTTGGTGATGTGGCTGG + Intergenic
968862121 4:3180821-3180843 GTGGGGGGGTGTGGTGGAGTTGG + Intronic
969329279 4:6463726-6463748 TTGGGGGGTGATGATGTGCTGGG - Intronic
970385539 4:15553040-15553062 GTGGGTGGGGGTGATGAAGATGG - Intronic
971300979 4:25442274-25442296 GTGGGGGGTGGGGTGGTGGTGGG + Intergenic
972404578 4:38733860-38733882 GTTGGTGGTGGTGATGGTGTTGG + Intergenic
975780387 4:77833192-77833214 GTGGGGGGTGGGGAGGAAGTGGG - Intergenic
976601992 4:86946439-86946461 GTGGGGGGTGGGGGTGATGTAGG - Intronic
977268691 4:94887380-94887402 GTGGGGGGTGGGGGTGAAGGTGG - Intronic
977568509 4:98607003-98607025 GGGGGAGGTGGTGAGGCAGTTGG + Intronic
977922128 4:102657232-102657254 GTGGGCGGTGGTAATGGAATAGG + Intronic
978512989 4:109541790-109541812 GTGGGGGGTGGGGTGGGAGTAGG - Intergenic
979127862 4:116998915-116998937 GTGGTGGGTGGAGAAGGAGTAGG - Intergenic
979431866 4:120642156-120642178 GTGAGTGGTGGTGATGGAGAGGG - Intergenic
980303733 4:131028293-131028315 GTTGGTGGTGGTGGTATAGTTGG - Intergenic
981937479 4:150251525-150251547 GTGGGGGGTGGGGGTGTGGGGGG - Intronic
982085295 4:151829517-151829539 GTGGGGTGTGGTGAGGGAGTCGG + Intergenic
982166330 4:152616969-152616991 GTGGTGGGTGGTTAGGTGGTTGG - Intergenic
986670812 5:10140907-10140929 GTGGGGCCTGGTGGTGTATTTGG - Intergenic
989052576 5:37335857-37335879 GTGGCGGGTGCTGAGGTAGGAGG + Intronic
989541921 5:42627981-42628003 GTGGGAAGTGGGGATGGAGTGGG + Intronic
989776889 5:45219664-45219686 GTGGGGGGTGTTGATGATGTGGG + Intergenic
990192832 5:53279832-53279854 GTGGGGGGTGGGGATGGGGGAGG - Intergenic
991224407 5:64252905-64252927 GCGGGGGGTGGTGATGGTGATGG - Intronic
991633952 5:68684357-68684379 GTGGGGGATGCTGTTGTATTAGG + Intergenic
994525413 5:100900759-100900781 GTGGGGGGTGGGGGTGGGGTGGG + Intronic
996277334 5:121682810-121682832 GCAGGAGGTGGTGAGGTAGTGGG + Intergenic
1000164528 5:158635104-158635126 GTGGGGGGTGGTGATGGGTGGGG - Intergenic
1001548639 5:172586528-172586550 GTGGGGGCTGGGGATGGGGTGGG + Intergenic
1003013489 6:2448920-2448942 GTGGAGGGTGCTGTTGTATTTGG - Intergenic
1003269154 6:4591976-4591998 CTGGGGAGTGGGGATGAAGTTGG - Intergenic
1004879878 6:19996774-19996796 GTGAGGGGTGGTGGTGAAGTGGG - Intergenic
1006350957 6:33520990-33521012 GGGGGGGGTGGTGGTGGTGTCGG - Intergenic
1006428714 6:33982330-33982352 GTGGGGGGTGGTGGGGGAGTGGG - Intergenic
1007167040 6:39835972-39835994 GTTGGGGGTGGGGTGGTAGTGGG + Intronic
1008842522 6:55920988-55921010 GTTGGGGGTGGGGGTGCAGTGGG + Intergenic
1008869814 6:56260043-56260065 GTGTGTGGTGGGGAGGTAGTGGG - Intronic
1010915590 6:81614040-81614062 TTGGGGGGTGGTGGGGTAGGTGG - Intronic
1011665650 6:89630307-89630329 ATGGTGGGTGGTGATGGAGAAGG + Intronic
1012253086 6:97001228-97001250 GTGGGGCATGTTGATGGAGTAGG + Intronic
1014770400 6:125453059-125453081 GTGGGGAGTGATGAGGCAGTGGG - Intergenic
1015527017 6:134183845-134183867 GTGGGGGGTGGGGGTGGGGTGGG - Intronic
1015806376 6:137113359-137113381 GTTGGGGGAGGTGGGGTAGTGGG - Intergenic
1016928508 6:149378783-149378805 GTTGGTGGTTGTGAAGTAGTAGG - Exonic
1017283752 6:152651101-152651123 GAGGGTGGTGGTGATGAAGGTGG + Intergenic
1017685153 6:156906079-156906101 GGGGGAGGTGGGGCTGTAGTAGG + Intronic
1017724924 6:157270166-157270188 GTTGGTGGTGGTGATGCTGTTGG - Intergenic
1017724981 6:157270478-157270500 GTTGGTGGTGATGATGTTGTTGG - Intergenic
1017812921 6:157997016-157997038 GTGGGGGGGGGTGGGGTAGGTGG - Intronic
1018291726 6:162298605-162298627 GTGGGGGGTGGTGGGGGGGTGGG - Intronic
1019056004 6:169223994-169224016 GTGGGGAGTGGGGATGAGGTGGG + Intronic
1019186131 6:170221346-170221368 GTGGGGGGTGGGGTTGTCGGAGG + Intergenic
1019909599 7:4091780-4091802 GTGTTGGCTGGTGATGTAGAGGG - Intronic
1019936723 7:4262796-4262818 GTAGGGGGTGATGAGGTAGAAGG - Intronic
1019936766 7:4262902-4262924 GTGGGGGGTGATGAGGTAGAGGG - Intronic
1019936782 7:4262936-4262958 GTGGTGGGTGATGAGGTAGAAGG - Intronic
1019936794 7:4262970-4262992 GTGGGGGGTGATGAGGTGGCGGG - Intronic
1019936837 7:4263071-4263093 GTGGGGGGTGATGAGGTAGAAGG - Intronic
1020125855 7:5532216-5532238 GCGTGGGGTGGTGATGGAGGAGG - Intronic
1021705607 7:23364587-23364609 GTGGGGGGTGGCGGTGCAGTGGG + Intronic
1022689717 7:32636914-32636936 GTGGTGGGTGGTGATGGCTTGGG - Intergenic
1023684408 7:42719739-42719761 GGTTGGGGTGGTGAGGTAGTGGG + Intergenic
1023962493 7:44938505-44938527 GAGGAAGGTGGTGCTGTAGTGGG + Intergenic
1024280870 7:47718490-47718512 GTGGGGGTAGGTGATGAATTGGG + Intronic
1024864712 7:53891961-53891983 GTGGGGGGGGGTGGTGTTGGGGG - Intergenic
1025084216 7:56009543-56009565 GTGGGGTGGGGTGAGGTGGTGGG - Intergenic
1027435381 7:78159037-78159059 ATGGGGAGTGCTGATGTGGTTGG - Intronic
1027647059 7:80814914-80814936 GTGGGGGGTGGAAAAGTTGTAGG - Intronic
1028168833 7:87571275-87571297 GAGGGAGGTGGTTATGTAGCTGG + Intronic
1028512492 7:91640810-91640832 TTGTGGGGTGGAGAGGTAGTAGG - Intergenic
1028513462 7:91650498-91650520 GTGGGGAGTGGTGATGGTGTGGG - Intergenic
1031151698 7:118061374-118061396 GTGGTGGGTGTGGATGAAGTTGG + Intergenic
1031556121 7:123179045-123179067 GATGGTGGTGGTGATGGAGTTGG + Intronic
1034007624 7:147491305-147491327 GTGGGGGGTCGTGGTATAGGAGG - Intronic
1034549585 7:151811781-151811803 TTGGGGGCTGGTGACGTAGCAGG - Intronic
1035783099 8:2244290-2244312 GGAGGGGGTGGTGATGGGGTGGG + Intergenic
1035809026 8:2475296-2475318 GGAGGGGGTGGTGATGGGGTGGG - Intergenic
1036821258 8:11942012-11942034 GTTGGGGGTGGTGATGTTTTGGG + Intergenic
1037081559 8:14793732-14793754 GTGGGGGATGGTGAGGCAGGTGG - Intronic
1037572539 8:20170918-20170940 GTGGGGGATAGTGACGTATTTGG - Intronic
1037674856 8:21043617-21043639 GTGGGGGGAGGTGGGGTGGTGGG - Intergenic
1037858508 8:22388552-22388574 GGGAGGGGCGGTGATGAAGTGGG + Intronic
1039790836 8:40874364-40874386 GTGGGTGGTGGCTATTTAGTGGG + Intronic
1041005385 8:53492781-53492803 GTGGAGGGTGGTGATGAGGGAGG + Intergenic
1043662331 8:82758924-82758946 GGGGGTGGTGGTGATGGAGTGGG + Intergenic
1044233710 8:89807016-89807038 GTGGGGGGTAGAGAGCTAGTGGG - Intergenic
1045237034 8:100361254-100361276 GTTGGGAGTGGTGATGGAGAGGG + Intronic
1045684041 8:104692807-104692829 GGGGGGGGTGGGGATGTGGGGGG - Intronic
1045883771 8:107071603-107071625 GTGGAGAGTGGTGCTGTTGTTGG + Intergenic
1046531508 8:115451953-115451975 GTGGGGGTTGGGGAGGGAGTAGG - Intronic
1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG + Intergenic
1049240975 8:141537194-141537216 GTTGGTGGGGGTGCTGTAGTGGG + Intergenic
1049543242 8:143218082-143218104 GTGGGGGGTGGAGTTGTGGGTGG - Intergenic
1049797047 8:144501629-144501651 GTGGGGGGTGGTGCTGTCCAGGG - Exonic
1050161097 9:2719055-2719077 GTGGGGGATGGTAGTGAAGTTGG - Exonic
1051391746 9:16572649-16572671 GTGGGGAGTGGTGGTGCAGAGGG + Intronic
1051392941 9:16586378-16586400 GTAGGTGGTGGTGAGGAAGTGGG - Intronic
1051535694 9:18154988-18155010 CTGGTGGGTGGTGATGGAGGTGG + Intergenic
1052563539 9:30116849-30116871 GTAGGGGGTGGGGAGGTAGGAGG + Intergenic
1052762491 9:32606976-32606998 GTTGGGGGTGGTGCTGAAGGTGG + Intergenic
1052821019 9:33137967-33137989 GTGGGGGCTGCAGATGTTGTGGG - Intronic
1052878945 9:33588291-33588313 GTGGGGGGTGGGGGGGTGGTAGG + Intergenic
1053497031 9:38555928-38555950 GTGGGGGGTGGGGTGGTGGTAGG - Intronic
1055514150 9:77020119-77020141 GTGGGTGGTGGTGATGGTGGTGG - Exonic
1056821679 9:89846479-89846501 GAGGCTGGTGGTGAGGTAGTGGG + Intergenic
1057514032 9:95705765-95705787 GTGGTGGGTGGTGATGGTGGTGG - Intergenic
1058485440 9:105439448-105439470 GGTGGTGGTGGTGATGGAGTGGG + Intergenic
1058894564 9:109388197-109388219 CTGGTGGGTGGTGATGTGGACGG + Intronic
1060919420 9:127409420-127409442 GTGGGGGGAGATGATGAGGTGGG + Intergenic
1060919433 9:127409452-127409474 GTGGGGGGAGCTGATGGGGTGGG + Intergenic
1061211863 9:129198316-129198338 TTGCGGGGTGGGGATGGAGTGGG + Intergenic
1061536888 9:131255840-131255862 GTGGGAGGTGGAGATGTTATGGG + Intergenic
1061839194 9:133347886-133347908 GTGGGGGGTGGGGATGGAGGGGG - Intronic
1062399479 9:136366158-136366180 GTGGGCAGTGGTGATGAGGTAGG - Intronic
1203772682 EBV:57645-57667 GTGGGGGCTGCTGCTGCAGTCGG + Intergenic
1185815081 X:3147013-3147035 CTGTGGGGTGGTGAGGTAGGAGG + Intergenic
1186390612 X:9154956-9154978 ATGGGGGGTGGTGTTGGGGTTGG - Intronic
1186465086 X:9778940-9778962 GGGTGGGGGGGTGATGTTGTGGG - Intronic
1187066198 X:15840698-15840720 GTGGGGGGTGGTGATGTAGTTGG - Intronic
1189957393 X:46289145-46289167 GTGTGGACTGGTGATGGAGTGGG + Intergenic
1190873366 X:54443338-54443360 GTGGGCAGGGGTGATGAAGTTGG + Intronic
1191714493 X:64185000-64185022 GTGGTGGGTGGAGGTGGAGTAGG - Intergenic
1192143022 X:68661044-68661066 GTGAGGGGTGGGGATGTTGGAGG + Intronic
1192198830 X:69050621-69050643 GTGGGGGATGGGGATGAGGTGGG - Intergenic
1193652460 X:84154649-84154671 GGTGGTGGTGGTGATGAAGTTGG - Intronic
1194786231 X:98087326-98087348 GTTGGGGGTGGTGGTGGGGTGGG + Intergenic
1195364111 X:104111223-104111245 CTGGGGGATTTTGATGTAGTAGG - Intronic
1195364415 X:104113002-104113024 GTGGGTGGGGGTGTTGTCGTAGG + Intronic
1196751906 X:119125894-119125916 GTGGGGGGTGGGGGTGGGGTGGG + Intronic
1197146492 X:123178134-123178156 GGGGGTGGTGGTGATGGGGTTGG - Intergenic
1197488426 X:127084100-127084122 GTGGGGCCTGGGGAGGTAGTTGG - Intergenic
1198409364 X:136350184-136350206 GTAGAGGGTGATGATGCAGTTGG - Exonic
1200075622 X:153549197-153549219 GTGTGGGGTGGTGGGGTGGTGGG + Intronic
1201140458 Y:11023264-11023286 GGGGGGGGAGGGGATGGAGTGGG - Intergenic
1201177269 Y:11316531-11316553 GTGGGGGGTGGGGGTGGGGTGGG - Intergenic
1201490156 Y:14532259-14532281 GTGGGAGGTGGTGATGTCCCTGG + Intronic