ID: 1187066759

View in Genome Browser
Species Human (GRCh38)
Location X:15847956-15847978
Sequence CTGTGGATAAGGAGCGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187066759_1187066764 26 Left 1187066759 X:15847956-15847978 CCATCCTCGCTCCTTATCCACAG 0: 1
1: 0
2: 2
3: 17
4: 226
Right 1187066764 X:15848005-15848027 AGCACTTAAACACTAGTCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187066759 Original CRISPR CTGTGGATAAGGAGCGAGGA TGG (reversed) Intronic
900389860 1:2429123-2429145 CTGGGGATTGGGTGCGAGGAGGG + Intronic
901463202 1:9404098-9404120 GTGTGCATAAGGACCGAGGGTGG + Intergenic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903548468 1:24141676-24141698 AGGAGGAAAAGGAGCGAGGAGGG - Intronic
905032690 1:34898290-34898312 CTGAGGATAAGCAGCCAGGGAGG + Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
906713293 1:47948731-47948753 CTGAGGTTAAGGAGAGAGAAAGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907379399 1:54073428-54073450 CTGTGGGCCAGTAGCGAGGAGGG - Intronic
907695312 1:56720760-56720782 CTGGGGATAGGGTGCGGGGAGGG - Intronic
908690628 1:66775596-66775618 AAGTGGATTAGGAGCCAGGATGG + Intronic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
914830180 1:151165431-151165453 TTGTGGATAAGTAGCTTGGAGGG - Exonic
914876213 1:151514147-151514169 ATGTGGATCAGGGGCCAGGAGGG - Intronic
917716048 1:177739144-177739166 CTGTGTAGAGGGAGCGGGGAAGG + Intergenic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
919920946 1:202166116-202166138 CTGAGGATGAGGAGTGAGAATGG - Intergenic
921300591 1:213748022-213748044 CTGTGTATGAGGAGCCAGGTGGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
924661008 1:246016701-246016723 CTGTGGAAGAGGGGCCAGGAGGG + Intronic
1063552357 10:7045018-7045040 CACTGGATAAGGAGTGATGATGG + Intergenic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1067942735 10:50669906-50669928 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1070370384 10:75776965-75776987 ATATGCTTAAGGAGCGAGGAGGG + Intronic
1070863977 10:79694869-79694891 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1071630876 10:87217095-87217117 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072512297 10:96139810-96139832 CAGTGGATAGGAAGAGAGGAAGG + Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1074406406 10:113183668-113183690 CTGTGCACAAGGAGCAAGGCCGG - Intergenic
1074642374 10:115401363-115401385 CTGTGGAGAAAGAGCCAGTAAGG + Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG + Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1087632153 11:100662520-100662542 CCGTGGATAAGGAGGGACTACGG - Intergenic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1089289059 11:117426863-117426885 CTGTGGATCAGGAACCTGGAAGG - Intergenic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091671701 12:2456746-2456768 CTGAGGAGGAGGAGCGGGGAGGG - Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092138451 12:6166418-6166440 CTGTGGAGAGGGAGCATGGAAGG - Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092938541 12:13386314-13386336 CTGGGGAGAAGGAACAAGGAAGG - Intronic
1096636091 12:52960562-52960584 TTGGGGATCAGCAGCGAGGATGG + Intergenic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100647142 12:96543469-96543491 CTGGGGGTAAGAAGCCAGGAGGG + Intronic
1101996289 12:109527629-109527651 CTGTGGCCAAGGAGCAAGGCCGG - Intronic
1103183528 12:118936090-118936112 AGGTGGGGAAGGAGCGAGGAGGG - Intergenic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1113673205 13:112189010-112189032 CTGTAGACTAGGAGAGAGGAAGG + Intergenic
1113680835 13:112243757-112243779 CTGTGGAGAAGGAGCAGGGCAGG + Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1115290746 14:31769356-31769378 CTCTAGGTAAGGAGCTAGGAGGG - Intronic
1115598201 14:34929431-34929453 CTGGACATAAGGAGCCAGGAAGG - Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG + Intergenic
1122847621 14:104509337-104509359 CTTTGGATAAATAGCTAGGAGGG - Intronic
1124365412 15:29067671-29067693 TTGTGGAAAAGGCGAGAGGATGG - Intronic
1128064498 15:64755900-64755922 CTTTAGTTAAGGAGTGAGGAAGG - Intronic
1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG + Intergenic
1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG + Intergenic
1130144071 15:81259304-81259326 ATGTGGATAGGGAGCCTGGAAGG - Intronic
1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG + Intergenic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1142234577 16:88915630-88915652 GTGTGGAGGAGGAGCGTGGAGGG + Intronic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1144174419 17:12691288-12691310 CTGTGAAGAATGAGCGAGCATGG + Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144791554 17:17862398-17862420 CTGTGGATGAGGGGCCAGGCAGG + Intronic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1147624835 17:41893255-41893277 CTGTGGACATGGGGCGTGGAGGG - Intronic
1148046398 17:44747637-44747659 CTGAGGATAAGGGGAAAGGAAGG - Intronic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1149930594 17:60750843-60750865 CAGTGGATAAGGAACAAGAAGGG - Intronic
1150326417 17:64262279-64262301 CTCTGGAGAAAGAGCGAGGGTGG + Intronic
1150901420 17:69282289-69282311 CAGTGGAGAAGGAGCCAAGAGGG - Intronic
1151562408 17:74877781-74877803 CTTTGGCTGAGGATCGAGGAAGG + Exonic
1151819751 17:76491115-76491137 CTGTGGGTACGGAGCCAGCAGGG - Intronic
1152223588 17:79082433-79082455 CTGCGGCTCAGGGGCGAGGACGG + Intronic
1155416694 18:25606206-25606228 CTGTTGATAAGGAATGACGAGGG - Intergenic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1161845347 19:6709035-6709057 CTTGGGATCAGGAGTGAGGATGG - Intronic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
930055200 2:47246525-47246547 CTGGGGATATGCAGTGAGGAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
931777912 2:65555980-65556002 CTTTGGACAAGGAGAGACGAGGG - Intergenic
936971044 2:118176585-118176607 GTGGGGAGAAGGAGCAAGGAGGG - Intergenic
937922875 2:127144338-127144360 CTCTGCATCAGGAGCCAGGAAGG - Intergenic
938229460 2:129646001-129646023 CTGTGGACAAGGAGCCATGCTGG - Intergenic
939090973 2:137780023-137780045 CTGTGGATAGGCACCCAGGAGGG - Intergenic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG + Intergenic
943600793 2:189918931-189918953 CTGTGGATAAGGGGGGACTATGG - Intronic
945151042 2:206792289-206792311 CTGTTGAAAATGAGTGAGGATGG + Exonic
948645787 2:239403041-239403063 CTGTGTATAAGGAGAAAGGTGGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG + Intergenic
1170227577 20:14008941-14008963 CTGTGTATAAGGTGTAAGGAAGG - Intronic
1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG + Intergenic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG + Intergenic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1177276023 21:18913791-18913813 CTCTGGATGAGGAGAGAAGAGGG - Intergenic
1177705596 21:24699946-24699968 CTTTGTATAAGGTGCAAGGAAGG + Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1180699390 22:17773465-17773487 GTGTGGATAAGGCTCCAGGAAGG + Intronic
1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG + Intergenic
1181438951 22:22925879-22925901 ATGTGGCTAAGGAGTGAGGGAGG + Intergenic
1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG + Intronic
1182096585 22:27630233-27630255 CTGTGGATTAGGAGAGGGGGTGG - Intergenic
1182281150 22:29218398-29218420 CTGTGGAGAAGGGGCTAGAATGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182704383 22:32267292-32267314 ATGTGAATAAGGTGGGAGGAGGG + Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
949587001 3:5451113-5451135 ATGTGGATAAGGAGTGAGAGAGG + Intergenic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
952002983 3:28808605-28808627 ATGTGGATAGGGAGCCAGAAGGG + Intergenic
952003335 3:28810853-28810875 AGGTGGATAGGGAGCCAGGAGGG + Intergenic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
959332600 3:105024555-105024577 CTGTGCATCAGGAGCAAGTATGG + Intergenic
960968138 3:123119753-123119775 CTGTGTTTCAGCAGCGAGGAGGG - Intronic
962861741 3:139409555-139409577 CTGTGTATAAGGTGTAAGGAAGG - Intergenic
965338307 3:167455425-167455447 CTGGGGATAAGGGGAAAGGAAGG - Intronic
968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG + Intronic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
973661523 4:53112063-53112085 CTGTGGATACAGAGCTAGGCCGG + Intronic
975280389 4:72555468-72555490 CTGTGGATAAGTTGCCAAGAAGG - Intronic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976284623 4:83359544-83359566 CTTTAGATAAGCAGTGAGGAGGG + Intergenic
978082897 4:104616368-104616390 CTCTGCTTAAGGAGAGAGGAGGG - Intergenic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981941295 4:150284132-150284154 CTGTAGATATGCAGCCAGGAAGG + Intronic
982802266 4:159720010-159720032 GTGTGGCTACGGAGTGAGGATGG + Intergenic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
986765730 5:10924317-10924339 ATGTGGAGCAGGAGTGAGGAGGG - Intergenic
990389861 5:55307789-55307811 CAGTGGATAAAGAGCGAGGGCGG - Exonic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
992554011 5:77885621-77885643 CTGTGGCTCAGGACCTAGGAGGG - Intergenic
995736173 5:115302182-115302204 CTGTGGAAAATGAGCAAGCAGGG - Intergenic
996562211 5:124843096-124843118 AGGTGGTTAAGGAGCGAGGAGGG + Intergenic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG + Intergenic
999537001 5:152528676-152528698 TGGTGGATAAGGAGCCAGAAGGG + Intergenic
1003271440 6:4611185-4611207 CTGTTCATAAGGAGAGAGAAAGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1005254553 6:23986775-23986797 CTGTGGACACGGAGCCATGAAGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005958165 6:30679104-30679126 CTGTGGTCCAGGAGAGAGGAGGG - Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG + Exonic
1007176803 6:39902737-39902759 CTGTGGATTAGTAGACAGGATGG - Exonic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG + Intronic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1012017624 6:93871765-93871787 ATGTGGAGAAGGAGCCAAGATGG - Intergenic
1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG + Intronic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG + Intronic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019224569 6:170499645-170499667 GCGTGGAGAGGGAGCGAGGAAGG + Intergenic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1026896482 7:74012849-74012871 CTGTGAATGAGGTGTGAGGAAGG + Intergenic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1037403976 8:18522253-18522275 GTGGGGATAAGCAGCGAGGGAGG + Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1040973444 8:53163444-53163466 CTGAGGATACAGAGCCAGGACGG - Intergenic
1041737001 8:61121381-61121403 CGGTGAATAAGGAGCCAAGATGG - Intronic
1042944962 8:74145263-74145285 CTGTGGATAAGGTGAGATGCAGG + Intergenic
1043996063 8:86817972-86817994 ATGTGGATAAGAAGCAGGGAAGG + Intergenic
1044479729 8:92671340-92671362 GTATGGGTAAGGAGCAAGGAAGG - Intergenic
1047512070 8:125523019-125523041 CTGTGGGTAAGGATCTAGTATGG - Intergenic
1048748504 8:137643585-137643607 ATGTTGAAAAGGAGTGAGGAAGG + Intergenic
1050747393 9:8892173-8892195 CTGAGGAAAAGCAGCGTGGATGG - Intronic
1052082315 9:24222371-24222393 CTGTGAATAGGCAGAGAGGATGG - Intergenic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053118033 9:35522592-35522614 CTGTGTATAAGGAGCTATGCTGG - Intronic
1056009635 9:82313694-82313716 ATGTGCATAAGGAGGGAGCAGGG + Intergenic
1056245909 9:84695125-84695147 CTATCTATAAGGAGGGAGGATGG + Intronic
1057912507 9:99031100-99031122 CTGTGGCAAAGGAGCCAGCAGGG - Intronic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1185746614 X:2578441-2578463 ATGTGGATTTGGAGCTAGGAGGG - Intergenic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187352617 X:18534899-18534921 TTAGGGAGAAGGAGCGAGGAAGG + Intronic
1188916934 X:35922935-35922957 AGGTGGAGAAGAAGCGAGGAAGG - Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG + Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic