ID: 1187066764

View in Genome Browser
Species Human (GRCh38)
Location X:15848005-15848027
Sequence AGCACTTAAACACTAGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187066761_1187066764 15 Left 1187066761 X:15847967-15847989 CCTTATCCACAGTACTGCCTCTT 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1187066764 X:15848005-15848027 AGCACTTAAACACTAGTCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 112
1187066762_1187066764 9 Left 1187066762 X:15847973-15847995 CCACAGTACTGCCTCTTTACTTA 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1187066764 X:15848005-15848027 AGCACTTAAACACTAGTCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 112
1187066760_1187066764 22 Left 1187066760 X:15847960-15847982 CCTCGCTCCTTATCCACAGTACT 0: 1
1: 0
2: 4
3: 4
4: 88
Right 1187066764 X:15848005-15848027 AGCACTTAAACACTAGTCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 112
1187066759_1187066764 26 Left 1187066759 X:15847956-15847978 CCATCCTCGCTCCTTATCCACAG 0: 1
1: 0
2: 2
3: 17
4: 226
Right 1187066764 X:15848005-15848027 AGCACTTAAACACTAGTCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 112
1187066763_1187066764 -2 Left 1187066763 X:15847984-15848006 CCTCTTTACTTACAAATAAAAAG 0: 1
1: 0
2: 3
3: 54
4: 616
Right 1187066764 X:15848005-15848027 AGCACTTAAACACTAGTCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187066764 Original CRISPR AGCACTTAAACACTAGTCAA AGG Intronic
906895074 1:49762188-49762210 AACACTTACACACTATTCATGGG - Intronic
910010473 1:82454971-82454993 ATAACTTAAATTCTAGTCAAAGG - Intergenic
911138841 1:94474767-94474789 AGCACTACAACCCTAGACAACGG - Intronic
912864423 1:113244676-113244698 AGGACAGGAACACTAGTCAAAGG - Intergenic
915619392 1:157070905-157070927 AGAAATTGAACACTAGACAAAGG - Intergenic
919341195 1:196309107-196309129 AGCATTAAGACACTAGTGAATGG + Intronic
921689695 1:218134127-218134149 TGGAATTAAACACTAGTAAATGG + Intergenic
924020269 1:239773696-239773718 AGCTATCAATCACTAGTCAAGGG + Intronic
1063003999 10:1951758-1951780 ACTTCTTAAACACAAGTCAAAGG - Intergenic
1064618939 10:17194477-17194499 CCCACTTAAAAACTAGGCAAAGG + Intronic
1067982086 10:51098008-51098030 AGAACTTCAACACAAGTCAGAGG - Intronic
1074493038 10:113955857-113955879 AGCACTTAGACCCCAGTCCATGG + Intergenic
1076629740 10:131845382-131845404 AGCATTTAATTACTAGTAAATGG + Intergenic
1078410572 11:11113355-11113377 ACCACAAAAACACTAATCAAAGG - Intergenic
1079421426 11:20293094-20293116 AGCACTGAAACAGTGCTCAACGG - Intergenic
1084900997 11:72309857-72309879 AGGCCTGGAACACTAGTCAATGG + Intronic
1088803304 11:113327358-113327380 AGCATTTTAAAAATAGTCAATGG - Intronic
1091968131 12:4763003-4763025 AACACTTGAACACTGGACAATGG + Intronic
1093232265 12:16560791-16560813 TGCACATAAACAGAAGTCAATGG + Intronic
1095457022 12:42398421-42398443 ATCACTTAAGGAATAGTCAAGGG + Intronic
1101612825 12:106307344-106307366 AGGATTTAATCACTGGTCAAAGG - Intronic
1105445211 13:20448207-20448229 TGAACTTAAAGGCTAGTCAACGG + Intronic
1106642880 13:31604334-31604356 AGCACTTCAGCACTAGGCATAGG + Intergenic
1112619594 13:101041049-101041071 AGCACTCAAATCCTAGACAATGG - Intergenic
1114158279 14:20132278-20132300 AACACTTATACACTATTGAAGGG - Intergenic
1114481795 14:23040408-23040430 TGGACTTCAACACAAGTCAAAGG + Intergenic
1114698711 14:24654030-24654052 AGCAATAAAAAACTAGACAATGG - Intergenic
1115098399 14:29667987-29668009 GGCATTTAAACATAAGTCAAGGG - Intronic
1115154864 14:30327005-30327027 ATTACTTAAACACTTGTTAAGGG + Intergenic
1116265256 14:42680164-42680186 AGCACTTATACACTATTGAGGGG + Intergenic
1117991406 14:61437512-61437534 AGTAGTTCAACAATAGTCAACGG + Intronic
1126115262 15:45202093-45202115 AGCACTTAAAAGCTAGGCACTGG + Intergenic
1133209683 16:4256710-4256732 AGCACTTAAACACCACACCACGG + Intergenic
1138036159 16:53608932-53608954 AGCACTGAAACACTCATCCATGG + Intronic
1138810417 16:60143207-60143229 AGCATTTAAAAACTAGCCATAGG - Intergenic
1139268252 16:65659517-65659539 AGGATTTAAACACTAGGCAGAGG - Intergenic
1140059100 16:71552343-71552365 AGCAACAAAATACTAGTCAATGG + Intronic
1154286851 18:13066170-13066192 AGAACTAAAACATTAGTCAAAGG - Intronic
1156985336 18:43344410-43344432 AGAACTTAAACTTTAGGCAAAGG - Intergenic
1158778789 18:60621058-60621080 ACCACTTAAAAAATAGGCAAAGG - Intergenic
1159795906 18:72843193-72843215 ATCACTTAAATTGTAGTCAACGG + Intronic
1161820629 19:6528903-6528925 AGGACTTCAACACCAGCCAAGGG + Intergenic
1164856079 19:31524303-31524325 ACCATATAAACACTAATCAAAGG - Intergenic
927892414 2:26760112-26760134 AACACTTAAAAATTAGTCAGGGG - Intergenic
928732691 2:34250818-34250840 ACCACTTATTCACTAGGCAATGG + Intergenic
931575596 2:63714880-63714902 AGCACATTCACAATAGTCAAAGG + Intronic
932799958 2:74732742-74732764 AGAACTTAAACAATAGAGAAGGG - Intergenic
934550691 2:95259783-95259805 TGCACTTAAAAATTAGTCAAAGG - Intergenic
945692071 2:213049172-213049194 AGCTCTCAAACAATAGTCATTGG - Intronic
946880061 2:224168521-224168543 AGCACTCAAATCCTAGTCAGTGG + Intergenic
948958505 2:241314727-241314749 AGCACCTAACCACTTTTCAAAGG + Intronic
1170679252 20:18510320-18510342 AGCACTTAAAAATAAATCAAAGG - Intronic
1170682186 20:18536357-18536379 AGCACCCCAACACTACTCAAGGG - Intronic
1172862925 20:38070256-38070278 GGCCCTTAAACACCAGGCAAGGG + Intronic
1173962914 20:47088957-47088979 AGCACTTCAACGCTAGTGAGAGG - Intronic
1174229690 20:49035578-49035600 GCCACTCAAACACTAGTGAAAGG + Exonic
1174847915 20:53961730-53961752 AGCAATTACACATGAGTCAAAGG + Intronic
1177071511 21:16514481-16514503 AACACTTACACACTGGTCATGGG - Intergenic
1177077403 21:16594578-16594600 GGCATTGAAACACTAGCCAATGG + Intergenic
1177591679 21:23178555-23178577 AGCATTTAAACACTAGCAAAAGG - Intergenic
1178706701 21:34880709-34880731 ACCACCTAAACACCAGTCAAAGG + Exonic
953209616 3:40864183-40864205 AGCTCTTAAACAATAGGTAATGG + Intergenic
954176052 3:48846973-48846995 ATCAATTAAACACAAGTCACTGG + Intronic
956805849 3:72810202-72810224 AGCACTAAAACAGTACTTAAGGG + Intronic
958667624 3:97160809-97160831 AGCCCTGAAACACTGGTGAAGGG - Intronic
959516867 3:107277443-107277465 ATCATGTAAACACTAATCAAAGG + Intergenic
960421227 3:117447870-117447892 AGAACTACAGCACTAGTCAAGGG - Intergenic
960674083 3:120178086-120178108 AGGACTCAAACACCAGGCAAAGG + Intronic
965993444 3:174848349-174848371 ATCACTTATAAACTACTCAAGGG - Intronic
970886717 4:20994891-20994913 AGCAATTAAACTCTAGGAAATGG + Intronic
973319093 4:48791768-48791790 AGAACCCAAACACTACTCAATGG - Intergenic
974670966 4:65029466-65029488 AGCACTTAAACACTATGGCAAGG - Intergenic
975872127 4:78791363-78791385 AGCACCTTAACACTAATCAAGGG + Intronic
977968271 4:103181808-103181830 ACCACTTAACTACTAATCAAAGG + Intronic
978099861 4:104825298-104825320 ATCATGTAAACACTAATCAAAGG - Intergenic
979321244 4:119327474-119327496 AGCACTGAAACCCAAGTCAATGG - Intergenic
981303305 4:143216018-143216040 ATCATATAAACACTAGTCAGAGG + Intronic
983397446 4:167218155-167218177 AGCACTTAAAAGCTATTCAGGGG + Intronic
984425345 4:179577977-179577999 AGCATGTTCACACTAGTCAAAGG + Intergenic
986835936 5:11637205-11637227 AGCACTTAAATACTAATAGAGGG + Intronic
986949394 5:13063636-13063658 AGCTGTTAATAACTAGTCAATGG + Intergenic
990525589 5:56623906-56623928 AACACTTAAACACCATACAAAGG + Intergenic
998124107 5:139604475-139604497 ACCAATTAAAAAATAGTCAAAGG + Intronic
1000419778 5:161025625-161025647 ACGACTCAAACACTAGTGAATGG + Intergenic
1001904144 5:175457080-175457102 AACAATTAAAAACTAGGCAAAGG + Intergenic
1004847180 6:19657398-19657420 ACCAGGTAAATACTAGTCAAAGG - Intergenic
1007533411 6:42563611-42563633 GGCACTCAAATACTTGTCAAAGG - Intergenic
1008529272 6:52440395-52440417 AGCACTTCATCACTAGGCACTGG + Intronic
1017087259 6:150725001-150725023 TGGACTAAGACACTAGTCAATGG - Intronic
1021212785 7:17876278-17876300 AGCACTTAAAAACTTGGCCATGG + Intronic
1023483027 7:40655356-40655378 AGCACATTAACACTAGTGAATGG - Intronic
1024597735 7:50954274-50954296 ATCACTAAGACACTGGTCAAAGG - Intergenic
1024868312 7:53930418-53930440 AGCTCTTAAACAATTGTAAATGG + Intergenic
1029018250 7:97337257-97337279 ATCAGTAAAACAATAGTCAAAGG - Intergenic
1031346721 7:120675803-120675825 CTCACTTATAAACTAGTCAAGGG - Intronic
1037042643 8:14256352-14256374 TGCACTTTAACACCAGTCAGGGG + Intronic
1041229442 8:55734263-55734285 ACCACTTCACCACTAGTCATAGG + Intronic
1041631649 8:60095317-60095339 AGCAGATAAACACATGTCAAAGG - Intergenic
1044875647 8:96663344-96663366 TCCAATTAAACACTTGTCAATGG + Intronic
1045815388 8:106271186-106271208 AGTACTAAATCACTATTCAAGGG - Intronic
1046867478 8:119166787-119166809 AGGACTTAGACACTAGGCATTGG - Intronic
1046871112 8:119206955-119206977 AGCACTTAAAAAATGTTCAAAGG - Intronic
1055547901 9:77400443-77400465 AGAACTTAACCACTACTGAATGG - Intronic
1056704345 9:88939438-88939460 TACACTTAAACATTAGTCCAAGG + Intergenic
1059627180 9:116079864-116079886 AGCAGTCAAGCCCTAGTCAATGG + Intergenic
1185569723 X:1124312-1124334 AGCACTTAACAAATAGCCAAGGG + Intergenic
1187066764 X:15848005-15848027 AGCACTTAAACACTAGTCAAAGG + Intronic
1190025067 X:46914542-46914564 GGCACTGAAACACTTCTCAACGG - Intronic
1193643263 X:84037672-84037694 AACACTTAAACACTTGTTAGTGG - Intergenic
1194040648 X:88938319-88938341 AGCCCTAAGACACTAGTGAAAGG - Intergenic
1197488113 X:127080195-127080217 AAGACTTAAACACTTTTCAAAGG + Intergenic
1198572185 X:137969793-137969815 ATCACTTAAAAACTTGTCAGAGG + Intergenic
1198670447 X:139074679-139074701 AGCACTTGAACATTAGTGTAAGG - Intronic
1201345025 Y:12973819-12973841 AGATCTTAAACACTTGGCAATGG + Intergenic
1201574457 Y:15447117-15447139 AGCATTTCAACACTATTAAAGGG + Intergenic
1201945014 Y:19502291-19502313 AGTACTTTTACACTAGTCACAGG + Intergenic
1202334651 Y:23794672-23794694 AATACTTAAACAATAGTTAAAGG - Intergenic
1202350896 Y:23989830-23989852 AACACTTAAACAATAGCTAAAGG - Intergenic
1202519883 Y:25680289-25680311 AACACTTAAACAATAGCTAAAGG + Intergenic
1202536116 Y:25875387-25875409 AATACTTAAACAATAGTTAAAGG + Intergenic